Transcript Name :
Phypl_g3138
Orientation:
(-)
Number of Exons:
4
Description :
hypothetical protein PHYSODRAFT_323421
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.2110.23328
InsideOutsideTMhelix
1-156
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2258 bases(100 bases per row)
TGCCCAGCATCCGCGGCGTGCTCATCGACCTCAGTGGTGCGTGTCTGGCGGTGCACCTGCCTATCTGCAAGCCCCACGTTAATCACTACCGTCTCCTTTC
GTGCAGGAACACTGCACGTGGAGGATGCCGTCCTGCCAGGCTGCGCTGCGGCGCTGACAAATCTGCTGTCCCGCCAAGATATCGGCGTGCGCTTCGGTGC
GTCAAGCTCTGTGTCTGAGTATACCTCTAATTTATAGCGCCCACCGTGTTCTTACGTGCATTGATTTCGCGGCAGTGACCAACACGACGACCAAATCTCG
ACGCAAATTGGTGCGTCTCGCGCGTACAGAATTTCTTAAAAATCTTGCAGACTAATGGTCGAGTGTATCCCAGATCCAACATCTGCACGATATTGGCCTC
AAGAACATTAAAGAGGAGCACGTACTGACATCGGGAGGCATCGCTCGTAGCGTACTAGAGCAACATAACCTTCGTCCGTTGCTGCTGGTGGATCCTTCGC
TCGAGGAAGAATTCGACGGACTTGACCGCACCAACCCGAACGCTGTCGTTGTTGGTTTGGCACCTGAGCACTTCCACTACGATAAGGTATATACAACGAA
AGTTACCTCGTGTGCGCAGGCGGCAGATGCTAACTACTTGCTTTCGGACAGCTTAATGAAGCGTTCCGCGTGCTGCTAAATGGGGGGTCTTTGATAGCAC
TGCATGAAGCGCGGTATTTTGCTGGGAAAGACGGACTTAATATCGGCCCCGGAGCATTTGTGAAAGCGCTGGAGTTTTCAGCAGGCGTTCAAGCGACTGC
CATTGGGTACTGTAGGAACTTTGCAACTTCATCTTCTTTTACATCGATAGTCACATGCCGATCCATATTTTACAACTACGACTACAACTAAATCGCTTCT
GTTTGCAGAAAACCCACACCAACATTTTACGGGCAAGCGTTAACGGACATGTGAGCACGCAACTGTCTGTTGCATCCGTCAATTGTGGTGCTGATGCAAG
GTGCGTGAATGTTGTTGTTCTCTAGGAACGTTGGCCCGGCAGAGGTGGTGATGGTTGGGGATGACGTTCGCCAAGACGTACACGGTGCCATGGTGTTGGG
AATGCATGGCGTGCTCGTCCGGACCGGTAAATACAGAAGTGGCGATGAAGCGAAAATTGGTACGTTGGGGCTTCCGTTGGGCTATCTTTAGTGTGGTAAC
TCAATCGAGGCTGGTTGGTGGGTTTAGATCCTCCTCCCTCCTACGTTGCTGAGGGCTTTCCAAATGCCGTCGAGTGGATTTTGGAGCACAACTCGTCCTG
ATTCAGGACGAGTTGTCGACGTCGCGGTGTCGGCCCAGTCGACGTCCCGACGTCCAACAGTCGTCGAGGGACGTCGACCTGCCATCTTGACGACATTCAC
CAGCATGTCACTATTTCAAATTAAAGACACACTAAAAACTGTCATGCTGAGGACATCGAGAAAATCGTGAGTGTACTTGCGTCATTTAGCCTTTGGTGCC
TCAGCGTCGCTACCAGTGATCGCCATCGTGCGCAACAAGGAGAGGTAACAGACGAGAAGCAAAACGGAGCTCATGGAGCTGAACCTGCACGTGGAGGACC
AGGGGAAGGCAAGCCAATGGGTTTGCACGCTACCGAGACTTACAACCACAGTCCCGGCGGCGATTACTTGCTTTGATCGACGAACGGCATTGAAGGCGCC
GAGATGTCAGACCAAAACCACATGTAGCAGCAGTAGCAACACCACGGATTGCTTTGGAGTGGTCGCTTCTCCATTAGCACCGACTACTACTGTTACAGTC
AACACCAAGAAAACCACCAAGACGAAGTTGTTGTTATCGCTGTACAAGAAGGTTTTGCGCTGGGTGGATCAGGTGATGTTGCATTGGGATATTATTCGAG
ATGGCGACAGCCTGTTGCTGGGCGTGCCGGGTAGCTGAGGTTCTTCGCCTCCAGACGATCGATCACCTCGGCCCGTTTTCAATCTGGCCCGGAAGACCGG
CAAACGCCACCAGCCCATCGAAGAAGTATATGCGCACGTTGGACGTGGGGCGAGATGAATGGTGCGTTGGTGTACAGCTACGTCTCGCGCATGACGCGCG
GAGTTTTGTAGCTTTTCAAGCTGGTGCCGGCGCAACACTGGACCAATCTGGCGGAGAAGTTCTTCATGTCCGTGGCCAGCTGCTCGAAAGCCAAGTGCTT
CTACATACAGCGCGACGTGGGGTTGCTACACTTGCTGAACTACGCGCAGGAGGTTTAG