Transcript Name :
Phypl_g643
Orientation:
(-)
Number of Exons:
5
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0670.06630
InsideOutsideTMhelix
1-270
*** None ***
PositionContextScore
138KKKRKRK|SA0.698
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2945 bases(100 bases per row)
TGACGTCGCTGTCTCGGGGCGGCTCCACCGCGAAGAAGGCCGCGTCGGCTGCAGAAGGTGCGTGACCATGGCTGCATCGGCCGCGTTAATTGATCGCCGT
GCTAACCGTTTATTAATACAGCTCCGATCTGGAAATTGTACTTGGCCATTCGTTCTTCCACCAGTGGTGCCAATGCCATCAACGCAGCGGATCAACTGAG
CAACACTAGCACCAATATATATCCACGTGGTCGTAAAAGACCAAAACCGTTGACCAGTCGAGGTGGAATGCATGGACCAGGAGCTGGAGTCTGGATGACG
CTGGCTACACCCCTAGTGACGACGACTCGACACGGTGGTGGAGAGGATGTTGTTGCTGTGCTACAGAGTGTCCGTCACTATTGGGAGCAGCTCAGCGTCA
ATGAGCGGCAGCAAATACTGTTCCTGGACGAACCGGAGCTTGTGAAGCAGCTGTACAAGCTCAACCTGAGTTTGTTGTGTGTCGGACTCATGCAGCGTCA
CCTCAAGACTTCCAATCGAGCAGCTACTGACACAGCAACTAATAGTAAAAAAGAGGTCGCCACGACAGCAACGACGGCAGCATCAAAGGTTGCATCTACC
ACATCGCCGACAGGGCTAGAGCGAGCAACGTCACTGCCATCCACGCGTTCGGCGACAGACACCTCTTCGGAAAAAACGTACGAGCTACTTGAGGCAATGG
AGTTTATGGATATTGGCACAGGTGCGTACACTACGAGGATGTAGCTCTTGGTGGTATTTTTCTAAGCTTGTCGCTCTCTTTTCGTTGTTGTGCAGGTATT
TTGACTGTAAAAACAGAGCTGGCGGAAGACACCGATCGGTTGTTTACACTGGTAGGAGATGTATTAGAGGGATTCTTGACATCCATTCACGTGCTCACGG
AGAGTAACTTCAACAAACTCTTCGTGGCGGAAAGCGAGACCATTAACACGTGGGCAAACTATCAACGCCTGATCGCGATGCTGGTGGAACAAGTACGAGC
TACTGGCCTATGTGAAATCGAAGCTGACACTCGTTCTAACACTGGTTATGTGTAATCTAGCTCATCCTACGAAGTTACGTCATCCATTTGGAAAAAGAAG
CAGCGCAGCAAATGGAGCAATTGTTGCTGGAAGTGTCGCTGGAGGATAAGGCAAAGGAACATAGCGCATCGGCCACCTCCAACAAGAAGAAGAGCAAGAA
GAAAAAGAGGAAGAGGAAATCAGCAGGACATTTATCGCTGCATTCCAGAGACCAAGTCAGGGGTGAATTGGTGGTGAATAGTGCTGATGGAACTGAAGCA
CTAGGAGATTCAAGTGACGATGTTATGGATGAGCCAGCACCTGAACCAACGCCTGAGCACAAGTCTATAGACAGCGACTGTCAGTCAAATTCATCAACAG
CTCAAAGGGATGAAATCGTTGTGGAAGAAGACGAAGACGTGTCCCCAGCAGTTGAGCCGTTCTCGAAGAAATCGGCGGGTTTAAACCCCAACGCTGTAGT
ATTCCAGCCTCAAGAGCATGTGATCGAAAGTGTGGACTCAAGAAATCCATTTGCAGGCAAGCGGAAGTTTGACGAGTACATTGTCAGTGTTCCGTGGGAA
GATGTCGAGAGCGAGGCTGGCAGTGCGTTCGAAACCCAAAGCTGCGACGGTGACTTCTTGGATAGAGACGATGTAGTCGACTATGGAGATTCGCAGCGGT
GGCGGAGGAAGCAGCGTAGACATGAAGAAGACGCCGAGCTGGAGTGGAAGCTACAACAGGTATACGCGTCCACCTCGTCGCTCTTTGGCTGGGACTTTTC
AAGGCAGTGCGAACTACCAGGCTCTGGTGCCAACCTTCCCTGGAGTGAGTCGATGTTATGGAAAACGGCACCAAAAGAAGTGGTCCGTTATTTTTCGCCC
GGAAATGGCGACGCGTACTCGAGATTTCAAGCGCCGCAGTTTCTGCCGCCTTCAGCAGGTCTTCCGCCGTCGCGATACTACTTCAACCCGGGTCCATCGA
TGCCATTCGGGCCTCCGTTGCTGGCTCCTCCGGCCATGGAGGCGATTCCGCAACACCTTCACGGCACCTTTGCCTTCCAACCTCCAGAATACCCCATGGT
GGTGTCGTCTCCTGATTTCTCAAATGCGCAGTATCATCCCAGCAACCATGAAGATCAGGTGGACGTCTAAGTACGTCCAGTTGGACAATAAGTGTGTTTA
TAAAATTAATTTATTGATGTACGACAATAATTGAGTCACAACGTCAGCTTGTAAAATCATAAATTAATTTATGCTTTAGGCTACAATAATTGTATGTGTG
GTGGACACCGTTTCGTACTTAGTGTTATTTGGCTTTGATAGCCGGCACTTGTGGTCGAGAGACTCCGACAGGTGCAAGAAGAGCTCGGGCTACTTTCGAC
ATGGCTCTGCTGCTGCGTAGCGTGACTTCCGCGGCCGCCAAGCGCGCGACCGCCTGTGCACTAGCTGACGTGGCTGCTACCTCCTCGAGTGTGCGTGGTT
TTGCTTCCAAGAAGGACAAGAAGAAGTCCAAGAAGGGCGGAAGCGACACCAACTTCGAGCAGATGCTGCGTGCCATCAAGGGCCAGTACCCCGACGCGTA
CGTTGCTTTACAGCTTTTATTGATACCGTTACTATTGACTAAATAATTATTATCGTATTTTGCTGCAGGGAGGAGTGGACAGAGGAAGAGAAGCAGCGTC
ACCAGGAGATCGGCCGCCGCTACAACGTCATGACCTCCATCGAGCACAACCACCTTATGCGCGACGTGCAGACCAAGATCGACTTCAAGTGGGAGGCCAT
TAACGCGCTGCCTGCTGAGCTGCAGGCCGAGGCGATGGAGACCGACGACGCACCCGCACCCGAGGAGCTCGGCTTCGCCACCTGGACGCCTCCCATTCCG
GGCTTCCGACGATACACGGACGAGGGAGACGAGACCATGGACTAA