Transcript Name :
Phypl_g636
Orientation:
(+)
Number of Exons:
5
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, RING-type11.545PS50089
Zinc finger, RING-type11.545PS50089
HmmSmart predictionP-Valprediction_id
Zinc finger, RING-type0.0045SM00184
Zinc finger, RING-type0.0045SM00184
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.4270.45237
InsideOutsideTMhelix
1-19
20-39
40-799
NN-scoreoddsWeighted Score
0.7391.5120.003
*** None ***
TypeScore
mitochondrial30.4
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
zinc ion bindingGO:0008270IEA
*** None ***
*** None ***
Sequence
        3459 bases(100 bases per row)
ATGTCCAAGGCTCCCCCACCGTCGGTGGCGCAGGCGTCACCAAGCTTCTCGAGGAATTACGTGACACTCGCTGTGCTGTCTGCCGTCGTGGCAGTACTCG
TGGCCGCCTGGACGTCACATGATTGGACTTTCAAACGCGAAGGTGTCTCCATTGAGTCCTCGACTGGCAATGCGTCTGCATCGCTGGTGGACAAGTACAA
TAGCGACGTGGTGAGGATCTTTACGCACCCGTTGCTGGTAGACGCAATGTCCGATCTCAAATGCCCGGACTTTCAACCGACCGCCGAAGGTTTGACGCAC
GTGGAGCTGGTGCTGGGGCATGAGCAACAGCTACGAGACCGGAACCAGGTCTTCTTCATGTTGAACGGACAGAACGAGGGGGTTTACATGCCTTGGACGC
ACCAACCTACCGGACAAGCGTGCATCTTGGAGCTGACACAGACGGCAGCGCTGAATCTCGGAGCGGATCCGGACTTGCTAGCCAATGGGGTAAAGCTCCT
CTCAGTCGATGGCTTGCCGATCCTCAATGCGGATGAATTGGACGTAAAGCGTATTGCTCACGTACTGCTGGATGGGCAACTCTGGGTCTGGCCTGGGATC
AAGGTGGGATACAAACGGGAGATCGAAGGCTGCACCGTTACAACGCAGTCGCTTCATCCGAAGGTGTTCACTGTGGAAGGTTTTTTCACGCAGGAGGAAG
CGGATGCGATTATTGCTGAGGGTGTCGATCACCTCTCTCGCTCTCCGGTCGACAGCCCCAACGCAGAGGACGGATATCACGTCGATAGAACGAGCTTCAC
AGCGTTCCTGGACGACAGCAACTTTACTAGGGACTTTCGCGTGCGGTCATCACGCCTGGCTCGACTTCCGTCTCCTAGTTATACCGAGAGGATGCAACTT
GTGCGATACGAAACTGGTCAATTTTTCCGCAAACACGAGGATTACTTCGACTCAAAGGAGTTCGTACCGACCAAATATTTCGCCGCCGGCCAATTTGAGG
AGTGGATTAACTGGGCATCGTCCAAAATCAATCAATTGCGACAGGAACATGTTGACAATATCGTCCCTGTGGAGTTCCTGCCAGAAGGTGAGATGTACCC
CGATATTCAAAGCACAACAACGTTTCATCACGCGCTACTCAAGGGCTTCATGGAAGATGCTGAGGTGAGCAACTTCTTCTGGGAACATGCCGACTTGGAG
TGGAGGGATTGGATTGCTGAAAATCTTGATCGAGCAGCAGACAATATCATGGGTCCGATCTTGGAGAGCAAAGGTTACATGCTGCCATTCATTGTGGCGT
CATGGGCGAAGCGAGCTGGCCATTCTGAGCTCGTTTATTCATTTCCGAAAGCCCCTATCAGTGGCGTTTCCCACTACTTCAGATGGATACAATGGTCAAA
GGAACGCGTGCAAACTCTGATGGATACGCAGCCAGAAGCTGTTCCAAAGCGCGTGAGACCTGAAGGTGAAGATTATCCGACATTTTACATGAGCTTTCAA
AGCCGCGTGGCTAGGCATATTCTCGAAGACTATAGCCGCGAATTTCTTGTCGAGACGCTCACCGGAGATTTCTACGCGTGGCTTGTTGACAACAAAGATA
ACGATGACGTTATACTGGAGCTTCTTCGTAGCAATCCCTCTACGTTCGACCTTGTCGTAGAGTCCTGGACCAAGCGCGCTGGCGATCTATTCACCTACGA
GAAGCCAAAGTATCTGCACCATTTCGAACCGAATCGCTTCGCGACGCTGTTTCTGTATCTAAACGATTGCCCTGAGGGTGGCGAGACGGTGTTCCCGTAC
TCGAAGGAGCGACTGGTGACTGGAATCAAGCGGGAGGGTATGGAAGAGTGCTCTGATGGTCTTGCGGTGCCGCCTGTGAAGCTTACGGCTTCGTTATTTT
ACTCTCAGACGCCAGTGAATGGATTGGACCCAGCAAGTCTTCACGGTGGTTGCCCACCAGCAAAAGGTGTCAAATGTACGTCGGTATAATTCTTTATTTT
GTGCTGAAAACTTCAACTAACCAACAAATTCTTTTGCTGTAGTCGGGGCTAACTCCTTCATGTGGAATGCTGATGCGGACGAGGGTGCAAACGCTTGGGG
CATGGGCGAAGACTTTAAAACGATGTCAACAGTATCGCAACAATAATAAAATACTATATAAATACGATACAAATTCCTGCGTCAAGTCTATAAAAAAAGC
GACCAAGACAGCAGAAGACTGCACCCCTCAATTCGACACGATGGGCCACACAGCTAGCGTGCATCGGCAGCGACGTAGCTCGACAGGCACGCTGTATGGA
GAACCCGCAGGCGCATCTGCAGCGCCACGTGGGAGCTACACGCCTGCGCAGATGCAGGCGCTGTATCTGAGTCGAGGAAGGCCGGACATGGCCTTCATGT
CGAACCAGGGCCGCACCCCCGTCGACGTCCCCGAGCTACAGCAGACGTGTACGGTGAGGAATCACGTGAACCTCAAGAAGACCAGTCTCAAGCTGCAGCA
GTCGCCCACAGAGGGGCAGCAGTACGCTCTGGAATTCCAATTCGACGCCACCAAACCATGTGACATCAGTGTCTATTTGGTGGCATCAGAGACCGTCGAC
GCCGACAGTGGCGGGTCCAGCTTCGCGCTGGTTCATACAGACAATAACCCGGTACTTACTCGGCACTTCAAGTCAGGTTTAGGACAGACCTTCGTTCTTA
AAGGGGGCGAGAAGGATGAGACTGCCGCGGATACCGAGGAAGAGAACCACGAGGAGCCCTTACCACTCTTGGACTTCTCGCCATACAGTCCGGATGAACT
GGTGTACAAACCCGGCACGACGCAGTTTCCGTTGATCGTTGTGCTTGAAGTATCTTCAACCAGTGAGTGTGTATTGAGCGATTTCCGAACTTTCCTTCTG
CTTATTTGTTGTGGTTGTTGATAGGGAAAAGCCCGCAATCTCAGTCGACATTCTGCACATTCGTCAAGAAAGGAGACGAACTGTGGGATATCAAGATGCT
CAAGCAGAAAATCTTGGCAAGAATAGTTGTCGGAGCGCCATCAGAAATGCTAGAGCTGACTCTTGTGTCTGTTTCACTTGTTTAGGTTGAAGGGTTGACG
TACGAGTTGCAGGAGATCTACGGCATTGATGGATCAGTGGCGGCAGCACCGAAGACTGAGAGGAATGGTGCAGCCGGCGATGACCAAGCTGGCATGACGC
AGACAGCCAAAGATGAGATTGAAATCTCTGAAGGTGCTGAGTGCATTATCTGCTTGTGTGAACCGCGTAACACTACAGTTCTTCCCTGTCGGCACATGTG
CCTCTGCAGCGAGTGCGCTGAAGCATTACGCAAGAGCTCTAGCACGTGTCCCATTTGTCGGACACCCGTTGAGGCATTGCTTCAGATTCGAGTCGAGGCA
AAGGAGACCACGACGACAGAAGCAGAGGACGACAAGACTGAAGTGGAAGATGTCGAGTG