Transcript Name :
Phypl_g5
Orientation:
(+)
Number of Exons:
4
Description :
kinesin-associated protein, putative
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Armadillo0.24SM00185
Armadillo0.24SM00185
Armadillo9.8SM00185
Armadillo9.8SM00185
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.1060.069114
InsideOutsideTMhelix
1-639
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        2142 bases(100 bases per row)
ATGAGCTCCCGAACGAGCTCCAGCCGCGGCCCGAGCCACGCAACTGTGCTCAAGAGCGAGAAGCCCCGCAAGATCACGGCCAAAGCGGATGAGCTGGACA
CGTACATGGAGAAACTCTACGACGACGACGTCGAGTCCAAGCTGGAAGGGGCCAAGATGATCTTGCAACTGGCTGAGTTCGCAGGCAACATCGAGGCTCT
GGTACAAAACGAGTCGCTTATGGTCTGTGCAAAATATACTGTTGGCTGTGGCTTGATAGTGTTTTTAACTGTGTTCGTCTTGGCCTGCAGAGCCTCCTGT
CGCGAGTGCTGAACGACGACTACAAGAAGAGCTACGACTTCTCGCTCACCATGATGCGCATCTTCTGGTGTTTCTCCAACTTCCTGCAGTTACATCCACT
GCTGGCCAATTACCGCATCGGAGCCGTCACACTCAAGATCATCGAGTTCGAGCTCAAGCGCCACCAGTTACGTCTCGAGGAGGAGAAGCTGCTAGAGGGT
GCGGCCAAAGATGCCTCAACGGGGGATAAGGAAGAGATTTTAGCCAAGCTGGACCGAGAGAAGAAGCGAAACAAGAAGCGCATGAAGAAGCAAGACCAAC
TTCTGTGAGGATGCCAGTCTGGAAGGGTCATCTTTCGCACTAGCTTCTGCAGACAAAACTGAACTGACCTGTGTATTTTGTATTCTTGCAGGTACGTGTG
CTTCAGTGTGCTGTTGAACCTGGCGGAAGATATCCACACTGAACGAAAGATGGTCAAACGCAAGATCGTGCTGTTCCTGACAAAGGTGCGTTGTCTCTCC
TGTTGCTGTATAGATGCAAGCAGCTAACTCCTTTGTGAACTCTCGTTGGATAGCTGCTGGATCGCGTAGCGCCTGATCTGGTTATTCTAACCATAATCTT
TCTCAAAAAGTTGAGCATTTTTGAGGAGAACAAGGATGTCATGGTGGGACTTACGGTGGTAGAGAAGCTGGTGCGCTATCTCAACTGCAGCCACGACAAA
ACAATTCAGACAGCACTCAAATTACTCTTTAACCTGTCGTTCGACTCGACACTCCGCGAAGTCCTGGTGAGAAATAGTCTTATCCCCAAGCTTGTGGATC
TCCTCAAGAAACCACCCTTTCGAGCTCTCTCCCTGAGAATTCTCTACCATCTCAGCATCGATGACCGGTGCAAGTCGATGTTTACCTACACGGAGGCCAT
CCCGATCGTCATGCAGCTGGTGATCAATTTCCCACAGAACATTGTGGCAAAGGAGCTAGCTGCTTTGGCTGTGAATCTTAGCCACAACGCACGTAACGCC
GAGCTGATGTGCCAAAATCGTGGTCTAGAAGCGCTTGCCGCTCGAGTGTTCCGCACCCGCGACCCACTGCTCATGAAAGTTATTCGAAACATCTCACTCT
GGTCATACACGCTTCAAGAAGACCTGGTCAGTGACAAGGCGTACAAGTATCGTGGCATGTGGGCTCCGTTCGTGGTGTCATTCATCGAGCTATGCCTCAA
CACAGACAACCACGACTTCTCGATTGAAGTTCTAGCGACACTGGCGAACATGACTCCAAGCGATCTACCGTCCAAGACTTCGTGGGATAAACTGGTGACC
GATCACTCGTTGATCCCTTTCCTCAACAAGCTCCTAGTGCCAGGGTTTTCCCAAGACGATATGATCCTGGAAGTCGTGAATTTCGTCAGCACACTTTCAC
TCGAAGCAAAGTGCGCTCCTCTTCTGTCGTCCTCTCGGCTTGTGCGCACATTCCACTCGCTCTTCCAGGAGAAGCAGCATGACAACGAGCTCACCCTGCA
GCTGCTGTATGCTTTTTATCGCATGCTGCGCCACCCAGAGACGTTCGAGGAGATCCTCTTTGGCGTCGGTTTTGTACCGGACTTACTTCTCGCTGCTGAC
GCACCGAATATTGAGGTGCGCCGGATGTGCGACGTGCTCATGGACTTGATTCTTGACCACGACCTTAATGACGGAGGAACGATAGGCGACTTTGGACACC
TCATTCGGCAGCGAAGATTTGAAATTCATAATGCTGAATACCTCGAGATGATCCACAGCGAAACACAAAGTGCAGTCTTCCGCAAACACCACGGAATGGA
TGACGACAGTGGGAAGGAGGATGACGACGATGATGATGATTG