Transcript Name :
Phypl_g17
Orientation:
(-)
Number of Exons:
9
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
MIT1.2e-16SM00745
MIT1.2e-16SM00745
AAA+ ATPase domain2.5e-22SM00382
AAA+ ATPase domain2.5e-22SM00382
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
MITIPR007330
Y-scoreD-scoreY-pos
0.0290.0822
InsideOutsideTMhelix
1-386
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleotide bindingGO:0000166IEA
*** None ***
*** None ***
Sequence
        1981 bases(100 bases per row)
TGGAGAACAAGTTCATCCCGCAGGCGATCGAGATCGTGACCGACGCCATAAATGCGGACAACGCCAAGAACTACCAGGATGCCTTCCGCCTGTACAAGAA
GGCGCTCGAGCACTTCATGGTCGGCGTTAAATGTGCGTCTGAAGTTGCGCTGAGGGGATCAGATCTTCAAGGTGTTTTACTGAGCTGCTGCTGTTGTTAA
TCCAAACAGACGAGAAGAACCCGACGTCCAGAGAAATCATCATGAAGCGTGTAGAGGGATACATGACACGCGCAGAGCAGCTGCGGGGGATGCTGGAGAA
GGAGAACGCACCGAAAGCCGTAGCAGCGGCGGTGGACATGGACAAGTGAGTGTTGCAGGGAGTTTCGTGCATTTCTGGTACTGATACAGCTGTATGCAGA
GGCGAAAAGGATGACGAAGATGAAACAGACGCAGAGACAGCCAAATTGCGCGGTGCATTGTCCTGTAAGGTTTTGAAGAGAGTGCACACTAGGCTGGTCA
ACTTTTTTTGACAGTGCTTTGAACATGGTGCTACAGCGGCGGTCGTGTCCGAGAAGCCTAATGTCAAATGGGACGACGTGGCTGGACTCGATGCGGCAAA
GGAGGCGCTAAAGGAGGCAGTGATTTTGCCTGCACGGTTCCCGCAGCTTTTCACAGGGAAGCGGCGTCCTTGGAAGGGTATTCTGCTTTATGGGGTAAGA
TATTGAGGGTTATTTGTAGGCGTCGCTGAAGTTGATTGCACTAAACTGGGTTTTGTTTGTAGCCCCCAGGTACCGGTAAATCCTACCTGGCCCAGGCCGT
TGCAACGGAGGCGGACGCCACGTTCTTCGCTGTATCATCCTCCAGCTTGGTCTCCAAGTGGCAAGGCGAGAGTGAAAAGTGCGAAATCTAATTGCGATAC
AGTGGAGATTACAGTTTATCATTGCTGACTCGTTCGTGGCTTACGCTGTAGGTTGGTCAAGAACCTCTTCGAGATGGCACGTGAGAAGAAACCTGCTATC
ATTTTCATAGATGAAATCGACTCGCTTTGTTCGAGTAGATCCGAAGGTGAAAGTGACTCAACACGTCGCATCAAGAACGAATTTCTTGTTCAGATGCAGG
GGATGGGCAACAACCATGACGGCGTTCTGGTGCTCGGAGCTACGAATGTACCATGGGAACTAGACCCGGCAATGCGACGACGGTAAATATTTGTTCGTTG
AAAGAAGGGGGAGGGAAATTGCAGATAGCTGATGCTGTGTTACAAACCTGCAGATTCGAAAAACGCATTTACATTCCTCTCCCTGAAGTTGATGCGCGGA
AGGTAATGCTGGGAATTCACCTAGGTGATACGCCAAATGAGCTGAGCGACGCAAACTTCACAGCTATTGCGGAGAAGACGGAAGGGTACGATGTTTCAGA
TCTCGACAAGAGGGTGTTGATACTCATTTTTGCCGTTTCACTAGCTGCTCTGGTTCAGATATCTCGGTGCTTGTTCGAGACGCGCTCATGGAACCGCTTC
GAAAGTGCCAACAAGCGCCATTCTTTACTCCGGTAAGGCTGCTGATGGTTCACCCTGTGTGTGCTGAGTTTGATGATTTTTTTTTTCTACGTGTAGTGTG
ATGATAAGGCACACCCTGTTCGGAATGGTCCATTCTTGACACCGTGTGAAGATGACCCACCGTGCGCGTACTGCCACATGAAGCTCTCAACATGTCGCCC
AAAATGCCCAGACTGCAAGGTCCCGTGCCGACGTTGCGGAGCGCTACGCATGCGGCTATACGATCTACCAGATCGTGGCTATTCTGATGAGAAGCTGCGG
CCCCCAATGATTTCAATGGTAATGCTTCGCTTTCATTTCCTTACAGCTTGTGTAGTGACTAAATGTGCTTCTACTACAGAGCGACTTCACACGTGTCTTG
GAGCATTCGACAGCAACAGTAGCTCCTGACGAGCTCAACCGCTTTGTCAAGTGGACGCAGGAGTTCGGGCAAGAAGGCTAG