Transcript Name :
Phypl_g1
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein PHYSODRAFT_496419
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0930.08825
InsideOutsideTMhelix
1-345
NN-scoreoddsWeighted Score
0.7192.1330.004
PositionContextScore
90VARRHFR|LA0.542
TypeScore
endoplasmic reticulum43.5
GO
*** None ***
*** None ***
*** None ***
Sequence
        1120 bases(100 bases per row)
ATGAACTCGAAGAGTGCCGCACTGGCGGAGCAGTTGGTTACAAGCACGTACGTGAAGCAGGGTCTGGATGCCATTCGCTCGCGCGAGGCGTTGATGACGA
CACTTTTGGCCCAGCGTCGCCTCCCAGACGAAGGCTGGGATGATGCCAGCGTGGAATTGCTGCTGCAGACGCTCTCGGCAATGGACAGCAACAACTTCCG
GGGCAGCGCTGGTGCTGGTGAGCGCGAGGCGCGCGTCTTCTCTCCGATAGTGGCGCGTCGTCACTTCCGCTTGGCGCACGGCGTGGGGAGATCGGGTGAC
GTGGCGGCTGTGCAGCCTAAAGCCGCGGGTTCGTCACTCATGGTGCAATTGGCCAACGCTCTGGCCAAGGACGTACTTCGGCTCGCTGGGATGCGAGCGG
TGCAGGCGGCGCTAGTGCTGCCCGTAGCCACGGGTATGTCGCTCATGCTTGTCCTACTGCAGTTGAAAGAGCTGAAGCCTGACGCGCGCTACGTCATTTG
GCCTCGGATCGACCAAAAGTCCTGTTTCAAGTCCATTCTAGCGGCTGGACTTACACCACTGGTGCTGGCTAATGTCCTGGTAGAGGAAGAAGATGGCTGC
CCGGGTGGATACCTAAAGACAGACTTGGCAGGGATGGTGGAGTTGATTGACCAGTACGGGACTGACAGCATTTTAGCAGTGATGAGCACTACGAGCTGCT
TTGCGCCGAGGGCGTATGATAGCGTGCAGGAGATCGCCAAGCTGTGCCAGGATCGGGACGTTGGTGAGCAGCAAATGACGTCTTGAAGCCATTAACTTGC
TGGATTGTGTCTGACGAAATGCTGTTGTTGCTGCTGTTGGTGAAAGCCCACGTGATTAACAACGCGTACGGTGTCCAAGCTTCCAAGTGCGTCCATGAAG
TCGAGTTGGCTATGCGCATAGGCCGTGTGGACGCTGTAGTGCAGAGTCTCGACAAGAACTTCATGGTGCCTGTGGGTGGAGCAATTGTCTGCTCAGCCTC
GCGCGAATTGGTTGACCGCGTGGCAAAGTTTTACCCTGGTCGTGCCAGCGCCACCCCAACGCTCGACTTCTTCATCACCATGCTTCAGATGGTTCGTTCG
CCCGAAAGCCACGTGGTTTA