Transcript Name :
Phypl_g24
Orientation:
(+)
Number of Exons:
5
Description :
conserved hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.1120.10120
InsideOutsideTMhelix
1-196
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        840 bases(100 bases per row)
ATGGAGCGTGGACGTTTGGCAGCGCAGTTGCAGTTCATGGAGCACAATGCGCGTGCGCTGGAGGAGCTGGTGGCCAAGATGATGAAGGCCAGAGAGGAGC
AGGAGGCGTTTCTGGGCGTGTTCGCCAAGAGTTTGGAGGATATTGCGGCGCAGGAGGAATGGGCGCCCCTTGCGCAGTGTCTCGGTAGGTTGGGCGAGTG
CGGCCAGACGCTAGTGAGTGAGAGCCACGACGTGGTGATGCTACGGCCGGAGACGGAGATTCTGCAGGTGGTTACGCAGATCCAGGACTGGGCGATTGTG
CCTATGAAGGTGCGAAGTGCAAGCAGAGGAAGGAAGCGACGCTACTTACTTTTAAAAAAAATGCGTTAGAGACTGCTGGAAGATAGGGAGAAGGCCATCA
AGATCGAAGCCAAGCTGCAGAAGGAGTACGACGAAATGAAGGTATCTGGTAAAGTTTAAGGATGAAAAATAGACTGTGGCGCTGCTGACTGGTGCTTTTG
ACAGCGAGGAAGCTCGAGGGAGAAAGAGAAGAAGATGCGAATGCTGTCGGACCAGAAGCGGCGTGTGGAAAACGTAAATACACTCCTGGACACACACATG
GAAAACTTCGATCGCTACCGTATTCAGAAGATGAAGGTGCGTTGGAATGGCTTAGACTTTCTGTTTGAAATTGTGCTAAATGATTCTGAACGCAGAAAAT
CGTGAGCGAGTTGGCTCGCTCGCAGGCGTTCTACTACGCAAAAGGGTTGGAGCTCTTCGCTGTTCCGTGTCAAGATATTGCAAAACTCCACTCGCCTGAT
ACAACCAAAGGAACTCCCAAATCGAACCCTGCAGAGTCTA