Transcript Name :
Phypl_g3
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_492857
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Histidine triad (HIT) protein5.2e-20PR00332
Histidine triad (HIT) protein5.2e-20PR00332
Histidine triad (HIT) protein5.2e-20PR00332
Histidine triad (HIT) protein5.2e-20PR00332
Histidine triad (HIT) protein5.2e-20PR00332
Histidine triad (HIT) protein5.2e-20PR00332
Profile scan predictionP-Valprediction_id
HIT-like domain13.905PS51084
HIT-like domain13.905PS51084
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Histidine triad (HIT) proteinIPR001310
Y-scoreD-scoreY-pos
0.1520.30117
InsideOutsideTMhelix
1-164
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
catalytic activityGO:0003824IEA
*** None ***
*** None ***
Sequence
        494 bases(100 bases per row)
ATGCTCATCGGAGCTCTTCGCCGCAGCTTCCTGGCGTCCGGACACTCGCTTTCGCGCCGCCCGCTGGCCCCCTTCGCCCTCCGCGCCATGAGCTCTGACG
AGCGCTCGAAGGCCGACGCTGCCGCTGCCTCTGGCGCCTCCGCCGCAGTGGGCAAGACCATCTTCGACAAGATCATCAATGGACAAATCCCCGCCAAGAT
CGCGTACGAGGACGAGCAGTGTCTAGCCTTCCACGACGTGAACCCGCAAGCACCCGTGCACATTCTTCTCATCCCTAAGAAGCGCGACGGTCTCACGCAG
CTCGCACACGCCGAGGAGCGCCACGAGGCTGTGTTGGGCCATTTGCTGTACACCGCCAAAGTGGTCGCCAAGCAGCAGAACCTGGACAAGGGCTTCCGCA
TTGTCATTAACGACGGAGAGGATGGCTGCCAGTCGGTATTCCACCTACATTTGCACTTACTCGGAGGACGCAAGCTGGGGTGGCCCCCTGGATA