Transcript Name :
Phypl_g15
Orientation:
(-)
Number of Exons:
6
Description :
hypothetical protein PHYSODRAFT_354318
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Importin-alpha, importin-beta-binding domain11.648PS51214
Importin-alpha, importin-beta-binding domain11.648PS51214
Armadillo10.657PS50176
Armadillo10.657PS50176
Armadillo9.467PS50176
Armadillo9.467PS50176
HmmSmart predictionP-Valprediction_id
Armadillo0.0000000067SM00185
Armadillo0.0000000067SM00185
Armadillo0.000000002SM00185
Armadillo0.000000002SM00185
Armadillo0.0026SM00185
Armadillo0.0026SM00185
Armadillo0.015SM00185
Armadillo0.015SM00185
Armadillo0.0000024SM00185
Armadillo0.0000024SM00185
Armadillo0.00000014SM00185
Armadillo0.00000014SM00185
Armadillo0.00015SM00185
Armadillo0.00015SM00185
Armadillo0.000011SM00185
Armadillo0.000011SM00185
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0230.0763
InsideOutsideTMhelix
1-530
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
protein transporter activityGO:0008565IEA
nucleusGO:0005634IEA
cytoplasmGO:0005737IEA
protein import into nucleusGO:0006606IEA
*** None ***
*** None ***
Sequence
        2046 bases(100 bases per row)
TGTCGTTCCCCGCAGGAAAAGCACCGGAACGCAAGAACCTTTTTAAGAAGGGAATTGACGCCGATGAATCGCGTCGCAGCCGCATGGAAACCACGGTGCA
GATCCGCAAGACCATCAAGGAGGACCGCATGAACCAGCGCCGCCGTATGGTACGGCAATACATACACATCGGCTGTAAAGACGAAGGAGACGGTTGTATC
AGGACTGGACAGGACTTCTGCTTCCTTAGAGCGTTGGTCCAAGGCCTAGAGTCGCCTTCGTATCTTACACTTTAAGCTCTTATCGGAGTTAGGAGGAGGG
CTAACTCGTTGTCCATTGTCGATATATAGGCACCTGCAGACAACGGAGCAGCCTCTGCCTCGATGGATGCTGCCGGCGAAATGACGCTGGTGCAGCGGGT
AAGTATTGGATATACATACACAAGGAACTTGCAGACTTAACCATTATGCTGTTGTGGGATTGCAGCTATCGGAGCTTCCCCAGATGATGGCAGGCGTGCA
GTCGAGCGACGCCGCTGTTCAGCTGGAGGCGGTGACCAAATTCCGCAAGCTGCTGTCTATTGGTGAGCATCAGGCTACGATTCGAAGAATTGCTGTTGCT
AACTTTTGCTATTTATTCACCGTTCTTTTCCAGAGCGCAACCCGCCTATTAAAGAGGTGATCGAGACGGGTGTTGTCCCCATTTTCGTGCAGTTCCTGCA
GCGCGAGGACTTCCCCACGTTGCAGTTTGAAGCCGCATGGGCTCTGACGAACATTGCGTCGGGTACTTCTGCTGATACCGAGGTGGTGATCAACCACGGT
GCCGTGCCTATTTTCTGCCAGCTGCTGCTGTCCACGAACGATGATGTCCGCGAGCAGGCCGTGTGGGCTCTTGGTAACATTGCTGGCGACTCCATCGAGT
GTCGTGACATGGTTCTGCGTTGCGGTGCTCTGCGTCCGCTTATGCAACAGCTGATGGAGAATTCGAAGCCTACGATGCTTCGTAACGCTACGTGGACGCT
GTCCAACTTCTGCCGTGGCAAGCCGCAGCCCCAGTTTGACTTGGTGGCCCCTGCGCTTCCCACTCTGGGTCAACTCATTTATACCCACGACGAAGAAGTG
CTGACGGATGCCTGTTGGGCTCTGTCGTACCTGTCCGACGGCTCGAACGAGAAGATTCAGGCTGTGATTGAGGCTGGTGTATGCCGGCGAATTGTGGAGC
TGTTGATGCACCACTCTCCTTCCGTGCAGACACCCGCTTTGCGCACCGTCGGTAACATTGTGACTGGCGATGACGTGCAGACGCAGGTCATCATCAATCT
GAATGCGCTGCCGTGCCTGCGTGCTCTACTCGAGAGCCCCAAGAAGGGCATCCGAAAGGAGGCTTGCTGGACGCTTTCCAACATCACGGCCGGCAACCGG
GAGCAGATCCAGTTCATTATTGAGGCCGACATTTTTCCGTCTTTGATTGGCTTCCTGTCGACGGCCGAGTTTGATATCCGTAAGGAAGCCGCGTGGGCTG
TGTCGAACGCCACGTCTGGCGGTTCGCCTGAACAGATCATGCACCTTGTCAACCTTGGTAAGAGTTGCAGCATCAATGATTATTCTTTTTTTTTATCCGA
AAATTAACATGTTCTCGTATTTACAGGATGCATCAAGCCTCTGTGTGACCTGTTGGAGGTCAAGGATGCAAAGGTTGTGATCGTGGCTCTGGAGGGTCTC
GAGAACATCCTGCGTGCGGGTGATCTGCAGAAGACAGGCGACGTCAACGACATTGCCACGATGATTGACGAGGCGGACGGTGTGAACAAGATTCAGGCAC
TGCAGTACCATGCTCACGAAGGTGCGTTCGACCCATTGTATTCATTCATTGTGCTTGTACTCACACGTATCTATATTTTGTATGACAGACATTTATGTGA
AATCTATGAAGATTGTCGAGGCATTCTTCAACGGCGAGGAGGACGCAGAGGATAGTCTAGCGCCCGACACGGACGCTAACGCCCAGCAGTTCCAGTTTGG
CACGTCCTCGGACCAGCCCACCATGTTCCAGTTTGGACAGAACTGA