Transcript Name :
Phypl_g18
Orientation:
(+)
Number of Exons:
14
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Protein kinase domain0.0000018PR00096
Protein kinase domain0.0000018PR00096
Protein kinase domain0.0000018PR00096
Protein kinase domain0.0000018PR00096
Protein kinase domain0.0000018PR00096
Protein kinase domain0.0000018PR00096
Profile scan predictionP-Valprediction_id
Glutamine amidotransferase34.711PS51273
Glutamine amidotransferase34.711PS51273
GMP synthetase ATP pyrophosphatase domain80.393PS51553
GMP synthetase ATP pyrophosphatase domain80.393PS51553
Protein kinase domain13.899PS50011
Protein kinase domain13.899PS50011
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Glutamine amidotransferaseIPR017926
Y-scoreD-scoreY-pos
0.0640.10838
InsideOutsideTMhelix
1-1179
NN-scoreoddsWeighted Score
0.6433.9620.008
PositionContextScore
318GQNRTRR|RL0.581
TypeScore
endoplasmic reticulum44.4
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
pyrophosphatase activityGO:0016462IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        12690 bases(100 bases per row)
ATGTTGAAGTCGCTTTTCCTCGATATGGGCGTGAGCCAGTCGAAGGGAGGCGATGGCGGCGGTGTGCGCTGGAAACTGCGGCCACTAGTGCCCCGTTCGT
GGGTGGAGCTGGAGCAGCTTCTTCTCCGCTTCCAGCAGGAGGCGTATCGCCGTCGAACGGACCCCGCATTCCAGTATTTCATGCCGTTTGCCGTGTTTCA
AGTCATCGTGGCGCCGCTTTGTCTTCACAACGACAAGGCACAAATGCTGGCCATGTTCGAGGCACTAGACGTTAAGCGGACTAGGAAGCTGGCCGCCATG
GACTTTTTCAGTGGACTGGCCCTTCTTGTGGATGCGAAAAAGCCCCAGAAGTTCGAGTGTGAGGGCAATCGGCGTAAACAATCGTCTCGCACGGACTAAT
GCCTGCGGCTACAGTTGTATTGTCTCTTCTAGATAATGGAGGGTTGAAGACGCTTAACAAGTGCGAGTTGGAAATGGTGGTCTCAGCCGCAGCCAGGGGC
TTAAAGATGTTCGCGCCTGGAGCAGACGTGCTGCAGGAGTCCACGATGAGACCGCTGATTCGACGTACGTCCCTGCTGATTCCTGGCATGGTATTTATTT
GTCAATGTGGAATTACACATATTTTTTTCGTTGTCGTGCAGGTCTGTTTGGGGGCAATGACGAGGTTTTGCGGCAAATAATTGTCAATAAGGCGCTTGCA
GACCCAGAGATTCTATTTTTCATGAGCGACCTGGAGGCGGTGCGTGTTAAGACAGTTATGGGTGTGGCCAAATGTGCAGATTTTATTCGATGATGTTGCT
ATTGAGTATTTGCAGGGCATAGCAACGTCCTCTGATGATCTTCTAATACAGCAGGGAAAGATCATGCGCCACATGGCTTACCTCGATTATCAGGCTCTCA
GGGTGACAGTTTCCGGTGTGTTTAGCGTTGTTGGTTTTGGATCTATCGTTATTCAGTTTTGCAAACCTTGAACTTATCTGCCTATTTTGTTTATATCAGA
AGACAAAGGGAAAATAGCACCTGCAGTTGTTCCTACCAGCGGATCAAGCAAAGGGCAGCGATTATTAATGACCCCCTCGGCTCCTACAGCTGAAAGTTTT
GTTCGCAAACTCCAAAGTATCGTGTGCCCGCCGCCTGCAAAAGGATCCAATCAGTCCATTCGCGTACTATCTACTGTCGAGGTTAAAAAGTATGTCGATT
CACGAACCCTGCAGCGGTTGGTCAAACTTGTATCAGACGGCGATATATCGCTCTCGTGGGATGAGGTTGGTGTGGTCTCCTGTATTTTGCATTAGCTAAC
TAATTGATAAGAGCTCAATCCTGTAGGCTGAAGTACTCGTAAGAGAGATATCGGTGGACCAGTTCGGATTTGCCCGATGTGGCGACATCCTCCGCGTCAT
GAAAGCATGGGTGCAAACCTACCGACAAGAGAAACCAGAGGCTATTTGGGAAGTTGTGGGCACTTATTTCGTCGAAGGCGTCAAAAACATGGAGAAGCAC
ATGAATGATGCGCTTGCTGCTTTCGTCAAAAGAGCAACGAGGAAGCTGGGGCCAACTGCTCGCAGACGGACAACTGCAGCTAAGGGGCGTCTTCTCGAAA
GCTTACAAAATATCCTGCGAAGTGCTGATTCCGATGATGGTGAACTCCAGTGGACCCTTAGTATCCAAATTGGCAAGAAGACGACACCCGTGCAAGTACC
GCCAAGCTCTCTGGCATCGAAACGTGTCGGTGCTCTTGGTGTTCCTATCGATAATACCATCAAATTTCGACTGGGGATTCATCCACCGCAGAGTGACGAT
GTGACCACAAGACACAAAACTAATGTTGGGAAGGACGGACAACGCGACTACGAGAGCGATGACAGCCAAGAAGAGGATCCAGACATCGATACGATGCGTC
TTATTGTAAGTATTTTGCTGAATCCAGAGATCACAGGTAAATGCTATGGTCTTGTAAAAATGTGATGTACTATCAGTGTCGATAAATTGGGGTTGTGTTA
CTGAGAACAGACGAGGAAGGCATTGATCTCGCATCAACCGTAGAGAAAGCAGTGCAGCAAGATCAAGTGTGGTCATTATTTGCATCACTGTGGACCAAAT
GTTCAGGTACACACATGATCAGCTTACGCAACGCGTTTGTCCGAGCTGATCATCGTTTCTTCACTGCAGTAACCATGCATTCCGATATTCGAAGTGATGG
AGGGATACAGCCTGTTCTGGGTAAGTATCTTCGCGTCTGCATTGATTTCCGCGAAGATATTATATCACAAGTGGAGGTAAACGAAATTGGCCCTCATTGT
TTTGTTTCGAGTTCATATTCACTGTGTCTGCTTACCGGTATTCACTATTCAGGAATGCATGGGGACGTCGTTTGCAGCTGGAATGCGTAGTTTTTTTGTG
CTGGGTGAGCTGGATCAGTCCTTCTCAGATATTGTGAAAACTGCACAAGATATGGCAACGTTGTTGCAAGGCCTAGGGAAAAGGAAGAACCGGGAACGTG
CGATGAAAATGATTTTTGATGCGTTCGACACTGATCAGAGTGGTGAATGGAGCTTGCAGGAGTTTAATACATTCCTTCAGGCCATTGGAAAGGAAGCATT
TCGGGAAGCCTCACTAATGGAGATTTCTAGTGGAGCCTCGACACTATCACTCGACAAGTTCTTGAGAATGTACGAGAACTACCAATCTGCGAGACTTCTC
GAGATGATCCGTCAGCTCGGAATTGGTAAGAGAACCCTCGCTGATTCCTTGTTGACGACTAAAGCACTTTTCTGGTGTAGGTTCGCTAGGAAATATCGTG
AAGGGATCCGTCTCGATTACGTCGACGCTCAACGAACCGTGTCTGAAGGCTCTAGATGTGCTACTTAGCCCACTGCATTGGGCAGATGCGAGCTGGAAAA
AACTGTTTGCTTTCACCAGGAACACAAAAGATTGGCATCTTGAGCTATATTTCTCGAAGCTTTCAGAGCTCGTGGAACACTTCACTGGCCATGCTGGCAG
CAGAAATCCAGTTAATGACCCGCTTTTTGTGTCCTCGTTGGTAGAGCAATTCAAGGAATTTATACAACCCCCTCACGCCCAGCATTCCCAAGAACGACCA
TGTCGTAGCATATTTTGTTCCCTTGAGCGTGACATGAACAAGACAGAGCAGCAATTGGAATTCGATGACCACAGCAAGAGACTGCCGCGAGGTACATCTG
CTCGACGTGCTGAAGGCATGGTTCTGTTTCTGAAAATGGCAAAACTCGTGAAAGCGCATGTCCAAGGTCCAGAAGTACTTGAAATCCGAAGCAAGAGTAT
TCGAATCGTTTGTGAGCTTGATAACGTCAGGATCACACCGAGTAAAATGAAACACTGATTCTTGCTAATCGTGGATTATATTTGCGGTACAAAGCATAAT
TTTAGGGAACCCCACGACAGCACCTCGAGTGCTTGGGTAGTGAAATCAACGGAACAATGAATCGTGGGCGCACAATCATACCGGCTTGTAAAGATGAAGG
TGGTCTGTCGTTCTCGAGCGAAGAATCCAAGACAGCTTATGCCGAGGCACTCCAGAGTCGCCATCGTGGTATGTACCAGGATGCCGTTGACGCGTTGGAG
CTCATCATCGAGGTAAGTGGCCATGATCTCACCTCCATATTCTCTTTATACCAACCGCTTTTTATCCTACAGCGTGAAGGTGACTCAGAGAAGCTTTGGA
CTGAACTTGCACTTACGCAGTTCCAACTATGGGAATCCTATGTCAGGGCGATGCATATGCCTTCCATTCTCGAAATTGCTTCCGCAACACAATTGAAGCG
ACCCAGTGGCTCAAATACCAGTGACAAACCACTTCATTCCGTGCTCCTGCAAGAGGCGTACAGCACTTTCCTCATTGCAATGGAATATCCAAACAGCAAA
TCGAGTCCAGAACTACTGCTGCCGTTGGCGAGGCTTTATATTGAATTCGGATCATTCAAGGGTGCACTTGCTGTTTGTACATTGCTGGTGGAAGGATGCC
CAACATCTCCACGTCTGAATGAAGCCATCTTCTTGTCGGCGCTTACAGCTACAGCACTAGGTCGTCACCGTGAAAGCGCACAGTACTTCCAGTATTTAGC
TGAGGGCCAGGGATCATCTTCGTCATTCCCGTTTCGCCTGGCAGTGTACCAATTCAGTCTGCTAGCAGCATTGGAGCTATCACATGTTCCAGGTATGCGT
CCACTAGAACGTGAGACGTACACTCAAGCGTACAAAGCTCTCGTTGCACTTCCACCAGTATTACCCTCCGAGAAGTCTGCACGCACCGTGTTCACAACAT
CTCGGAAGAACGAAGAACAACGCATATTACTATGGTGTCATGATCCGCAGACGTGGATAGATCTAGCCCAGCGCCTCGCAGGTCCAGCCAACGCACCACT
TCTCGTTCTGTCAGCTCTTCGTGAAGCTCGCCGCAGAATGAAAAAAGCGTCTGGCAGTCTACCAAGTCCCAAACTTCTTTTGGAAGGTACCAGCCTATTG
CGCACGGGAGACGACCAGGGAGCTGAGACAGCGTTTGCTGAAGCGCTCTTGCAGCTGTCACGTAATGCTTACTACACTGCCAGACACGAACGATTTCTAC
TGGAAGTCTGCAGCGCTTCCTGGCGGAAGCATTTTGCATTGGAGAACAGAAGCGCATCACGTCTGCAAGTTTTCGTTCGGCGACGTGAAATTTTGGCAAA
GTGGCGCCTCGGTGTTGCCTACGTCTTGGAGCAACGTCGTATTGCGATGGCAATCAGAATTCAATGCGCTTGGAGACAGTTCAAAGCGCGAAAGGAGCTT
GCATTTTTGCGCGAAAAGCAACGAGAGAAAGAAGCTCTGGCTAATGAAACCATGGGCCAACAAGATGACCGGCTGATTGAGCTGTGGCTGAATGCCGCTG
CGAGGAAAATTCAATCATTGCTTCACATCGCCCGAGCCAAACGTACGCTACGGGCTCTTCAAGCACGGAAAAATGAACGGGAGGCTCTTTTGGCAAAGTT
TGCCGGCCGTCGTACCGAGCTTGGCCAGCTGGGAGTGTTCCGTAGGTGGCGTAACTTCGCTTCTACTCAAAAAGAGGAGCGTCTTGGTGCTATTGTACGG
ATTCAACGACAGTTCCGAGCCTGGCGCAGTCGCAAGCTCTGCTTTCAGTTGCTGCTGCTTCGTCAGCAACAGAATAGCATTTTACGACAGTGTCTTGCTC
GGCGAGCGACGTCTTTAAGCTCTCGGGTGTTTCAAGCATGGCATACTGAGCTTGTCAAAGCTCGAAAGGATCGGGAATGGGCTTCACGGCTCATTCAACG
GCGATATCGTTCAAGATTAGCTGTACGCCAGTACCATGTCGAGCTACGACGTCATCGAGCGGCAACGGCTACGATGAACCGCCTGCTCTCAGATCGTAGG
AACCAAATGCTGTTGAGTTCTTGGCGAGCACTTACAAACCACGCGCTTGTCCGTCGTCTTCGCAAACGGGGAGCAGCAGTGACAATCCAAAAGCACGTGC
GAGGTACTATTGCCAGACGACTAGCTAAGCGACTTCGTGCACGTCGTCGACGAGCTCTCAATGTGCTAGTGAAGCTCACACAGTCGCGTGAATCTCAGCT
TTTGCAAGCAGCTTTCGACCGTCTCCGTCAACAAGTTGAAGCTTACCACCGGCGAAGATATGGAGCTGTGATACGCATCCAAGGTTTGTTCCGAGGCTTT
TGCACTCGTCAAAGACTGCATCGCCGACATTTAGCAGAAATGCTGGTAAATGGCACCGTAATATTCGGCAGTGGGTTAAAAGACCAACCCTCGGACATCA
AGCTCTGGGCATGTCTGCTGGCTCTCCAAAGGTACATTTCCCAACGTAAAGCGGCTGTACGTCAGCTACAGCGATGGTGGAGGCAGCGACAAAAGCGCTC
TCGAACTCTTCGTGTACTCAGTAAACGCGCAGCTCAACGGCGATTACTGGGGAGGCTGCAGCATAACTTTTACAGCATTGCTCGAATCTTTTTTCGAGCA
GTTCGTGCAGAATGCGAAGCCAAAAAGGCTCGACGTCACGACGCAGCAACCAAAATTCAACGTCGACTGCGATGCTGGCTCATGCGTCGCAGGTACCTCA
GTACTCTCGATAGAAACTCGGTCGCTGCTCAACGTGGTGATAAAGCGGCGAAGAAATTAGCGTTCCAGCGAGTGCGTCGATTGTTTTACGGTTGGAGAGA
AGCAGCACGAGCCACTCGAAGAGAGCAGATCGACGCAGCTTGTTTGCTTCAGCGAACCTTTCGTCGTCATCGAGCGCAACGCCAAGCACGTTGTGTAGTG
GCCAAAAAGGCAGCCCAAGCAAGGCTGTTTGCGGCTGCCTCACAAAAGCCGCTGGAGCGCTGCTTCCGCCAGTGGGAGGCTGTGGCTCTACTTGAGAAGT
GCGTGCTGCGTGTACGTAGCTCATCGCTAACCAAGTCAAGAGAAAACACGCCTGTCAGCAACCAGAGGAAACCAGGCACCGCTGGTGGGGGCAAGTTCGA
GAAGCCACGGACGCTCGAAGAGGTAAGTGAAGTCTTTATCCTGTAAATTGCATCACTAACCCCCATGATCGTGTTCTGACTAGCGCGCGGAGATACCTTC
AATGCTCTTCTTCACGCTTCTCAACCGTGTGCGCCAGACAGGGATATGCCAGCTCTCATACAGGTACGTGGGTAGATCTCACAGCACTTTTCCACTTTTA
ACATATTCATTCTCAGCGGTGGCACCGTGTTCAAAGGCCCCCAACTCCGACAGCTCATTTCATTATCAACCAGTGTAATTGTTGACAGCGGAGGTGGACT
TCCCAGCACGAACCCAGTATCTACGAGCTCCCTTCTGAACCTCAATGAACACGTTGTCGATGCTTTGGATATGTGCACCAACTCCACTACCAGCTCGTGT
CCAGTGCAGTCTCTCATCCTGTACAACGCGCCACTCCGACCATCGCACGCGTCTCTGCTGTCCACCATATTGCAGCGCAGTCGCCGAAGTTCCAGTCTCG
CGCTCGTGTCTGTCGTGCTGGCTAATGTCCCACTCGCTCCTTCCTCCATTGTGGCTCTTGCCTGTGCATTGGCTCAGAGTCCAAGCTGCCTGCAACAACT
GGTGCTCGAGCGTTGTCAAGTGGGCAGCGCCGGTGCTGCTGCGTTGTTCGAGGCTCTGACTTACAACCGAGCGCTGTGGAAGCTCGATCTCAGCGGGAAC
CACATCTCCGACGCTGCTTGTCCATCTCTAGCAAGAGCTCTGTTATCTGGAAGTCCATTGCGCGTGCTGGCATTGAGTCGCAACTTTCTGTCAGACCGCG
GCGTGCTTGGATATGTGGCTCCAGCATTGGTTTCGAGTCAATTGGAGACGCTCGTGCTGCTACAGAACTCGCGCGTGTCCTCGCTGGGAGTCACGGCACT
GACTGCAGCAGCAACAGCAAGTTGCAGTGCGTCCTCAGGCTTAGTAGGGTTGCGCGTCGTTTCGGACTGAGAGCTGTGATTGGTCTGTGACATGGCTACA
AATAACGGTCTGACCGCTGATTGGCTGCAAGTGGCTGGCTGGTACGTCAGGAGTTCAACCGTGTCCGTGGCTGTGAGGCGCTCGCTGGTCAGAATCGAAC
ACGCCGAAGACTCGATCCGACCCCGTTTAACATGGCCGACGCCTCCCCAGTGACCAACCGCAAGCAGGTGGCTATCCTGGACTTCGGCTCGCAGTACAGC
CACCTGATTGCGCGTCGTGTGCGCGAGCTGCACGTGTTCTGCGAGCTCTACTCGTGCCTGGTGAGCGCCGACGAGCTGCGCCAGCACCAGCTCACCGGAA
TTATCCTGTCGGGCGGCCCGCAGTCCGTCTTCGACGAGGGCGCCCCGCACGTGCAACCGGAGGTGTGGAAGCTCATCGAGGAGCAGAAGCTGCCCGTGCT
CGGCATCTGCTACGGTCTGCAGGAGCTGGCCTTCACCAACAATGGCAAGGTGGCCCCCTCGCAGCACCGTGAGTACGGCAAGGCCATTGTGACCCGCAAG
AGCGACGTGGACTGCGGCGGCCTCTTTGAGGGCCTCCCGGACGAGTTCCAGATGTGGATGAGCCACGGCGACAAGCTGCACCAGAACCCGGACGGATTCG
TGGACATCGCCACCACCGAGAACTCGGAGCACGCTGCCATTGTCAACGTGGCCCGTCGGTTCTACGGTATCCAGTTTCACCCTGAGGTGACCCACAGCCC
GCGCGGCAAGGATATCCTGCGCAACTTCGTGGTCAACATCTGTAACTCGCCCACGGACTGGGACATGCGCAGCATCGCTGACGCCTTCATCGAGGAGGTG
CGCGAGACCGTCGGCCCCGAGGGCCATGTCATCGGTGCCGTCAGCGGCGGTGTCGACTCGTCCGTCGCTGCTGTGCTGCTGCAGCGCGCTCTGGGCGATC
GCTTCCACGCCGTCCTGATCGATAATGGTCTTCTGCGCAAGGACGAGGCCACCGAGGTCGTCGACCGCCTGCAGACCAAGTTGGGCATCAACCTCAAGTG
CATTAACGCGTCGGACCGTTTCCTGGCTGCTCTGAAGGGCGTCACTGAGCCCGAGACCAAGCGTAAAACGATCGGCAACCTCTTCATTGAGCTCTTCCAG
GAGGAGGCCGAGCGCATCGGACACCCCGTGGACTTCCTGCTGCAGGGCACCCTGTACCCGGACGTCATTGAGAGTATCTCGTACAAGGGACCTTCGGCCA
CGATCAAGACCCACCACAACGTTGGTGGCCTTCCCGAGACGATGCACTTGAAGCTCATTGAGCCGCTCCGTGAGCTGTTCAAGGACGAGGTCCGTGAGCT
CGGAATGGCGCTTGGCATTGACGAGCCCAGCGTGTGGCGCCACCCGTTCCCCGGTCCGGGCCTTGCCATCCGTGTGCTCGGCGAGATCACGCCCGAGGCG
CTAGAAACTCTTCGCCACGCCGACTCCATCTTCATCGAGGAGCTGCGCAACAGCGGCCACTACAAGACCACGGGCCAGGCCTTCTGCGTCCTGCTGCCGG
TCAAGTCTGTTGGTGTCATGGGTGACGGCCGCACGTACGAGAAGGTTGTTGCCATCCGTGCCGTCAGCACCTCGGACTACATGACTGCCGACTGGTACCA
CATGCCGTACGAGGTGCTTGGCCGCATGTCGAACCGCATCATCAACGAGGTTCGTGGCGTGAACCGCGTCGTGTACGACATCTCGTCCAAGCCGCCTGCC
ACCATCGAATGGGAGTAAGTGACCATGGAGTCCTCGCTTTTGCTGCCTCCCTTGCAGCAAGGTCACTAGGATAAGCAAGGCGGAAGACACGACACTTTTT
CCCCGGTAACGTCAAGCTAATAGAGCAACGATACGTGCATGTACACTAAACCAGATCAAATGAAACAAAAGCGGCAGGCACGCTGCCCGTTCCTAGCCCT
GAACCAGTTAGCGATAAGGAATTCTTAGCTTTTGCCTTGTCCAGTAACGACTTCCAAGTTGGAAGCTCCAACTCCTTCGATTGAAGACGCCACAGCATGC
GAGATGTCGATGGGTATGAAACTCTAATGGTGCTGGGCAGTGGGCAGTTCGGCAAAGTGGTGCTTGTCCGGCGAAACTCGGATCGAAAGCTCTTCGCTGC
TAAAATCCCGCACAACGAGGATAACGCTGCACGACAAGCAGCTCGCCACGAGGCCCAGCTACTGAAACACTTGCATCACGTGAATATCGTGCAATTCATC
GAGCTCATCGAGGATGACACGAATCTGACACTTGTGATGGAGTACGCCAGCGGTGGAGATCTGGACGCGTTCTTGCGGCGGCAACAAGAGCGCGCGTAAG
AAACTTGGTCAATGACTGATACTATTGCTTGTGCTGATCTTTCGCTGACTGCAGAGATCCCCTAAGCGAGCCAGCGATCATGCGGATTTTCATCCAGATC
GTCTTGGCGCTTCAGTACTTGTTCGGAAAACATATTTTGCACCGGTAAGCTTACGTAGCACCTCGTTTCTTGGTCGATCTACTCCGCTCAGCAGTTTGCT
TTGATCATGTTGTAGAGACCTCAAACCAAAGGTATTTTCTAGACCTCTGGGATGTCATGCCGATACTTCTAACCTACAATATGAGCGAGCAGAACGTCAT
GCTAGACGGTGACGGGATCGTAAAGTTGAGTGACTTCGGCGTCTCAAAGATGTTGCAGAACACTTTGGACTCTGCCCAAACTATCACCGGAACCCCGTAC
TACATGTAAGTTCGGTTTGCATCACGCTTCTTGTTTCTAATGGATCACTCCTGCCGGTAGGGCACCCGAATTATTAGAAGGCGACCAATATGACTGCAAA
AGCGACGTGTGGAGTCTTGGTTGTGTCCTGTACGAGCTCGCTACTTTTTCTCCACCATTCACTGGCTCAGCGCTTGGTGCTGTGGTGGGTATGATTTTGC
ACAGCGAGCCACCACCGATTTCAGAGCAGTACTCTTCACCGTTCCGAGCTCTTGTGGCGAATCTGCTCGAGAAAGACCCATACGTACGAAGGTGGTATCC
ACGTGTTTGCCGAACATTGTGTTCTCATTTGTTTTAATTGCTTGCAGAAACGACCAAGCTTGCTCGATATCTTAAGGTCCGACGCGGTTCAGCATCACAT
GATGCAACTGGTTAGCGTCGCGACTTCACACCAACCGATGATTCTCGAGCAGTTTGCTACCAGAATTACCACCCTCGATACCCACACTCCGATCAAGATC
GTGTCCTCATTTCCCAACCATCAACGCAACCACGACAGCAATAAAGCCGCGAACGAACTACCGGTTGTAGCAGCGGACAACCACGTCGTAATGCCACCAA
AGCCAATCCAGTCAGGAGCAGACCACGTCCGACAACTCTTCTTCGAGAACCAGGTGCGACTACGTCGGTCGGGGTTGCTATTCAACCGCAAGTGCAGTCC
TAACTCTTGCTAGATCTACAGGCAGCAGCTCGGAGGAACAAAGAGCGAATCGACCAAGAGAGATCCAGGGCTGCAGTGTTTCTAAACAGTGGCGATATGA
CTTCGGAGAAATCGCAAGCCATCTCAGAAGCGTCCATCCCAGACAGCGGTAAGAGCTGCGCATTCTAAAGAATAGTGCTTCATGTTCATTGTTGTGTGAT
GTGCCAGCAGTGGGTAAATCCTCTCCTGTGTCTTCGTCATCCAGACCTCGGTCGCACTCTTCACCGTACGTCATTAACAAGCTGGTATAGTATGCGCACT
AAAGTACGAGGCTCGTACTACGAGCTAACCTTCATTCATTGTGCAATTGCAAGCTCCAGCTACGAAGAGCTTTTGGATGCTGAGCGGCGGCGCGTGCAAC
TCGAGACCAAAGCGCTGCAAGAAAGAATTCGAGCCATGCAGACCGCAGATTAGCTTGCAGCTGACGAGAAGTGGCCATCTCTAGGTACAGTAATCTGCCT
GAGTAAGGAACGCCTGATATATACTGAAATATAGGGGAAATAGAATGGTGTAGATCAAATAACCTCCTTTCTTTGTCCCACTAAAATTAGGTATGTCAGG
CTATTAATTTTTACCCCGTTCCTTACTCAGGCAGAATATTGTAACTCCCAAGGAGATTAGCTAGCCACTTCAACTTGGTTATCTCGAAAGAGTGCCATAC
TAAGGAAATAAAACCCCGTCATTAAATCGAGGTAATCGTTGTGATGCGTGTATCAATCGATCTCTTACCATGACGAAGGCCAAGCAGTTCGTTGAGTTCG
GGTGCGTTGCAGCGTCACCAGCAGTTCAACCTCTTGTTCTTCGTTGCTCTTCCCTAATGCATTGATGTTCTCTCCCTCCCTTCAGCAAGAAGATCGTGGC
AATCGGGAAGAATTACGAGGCCCACGCCCGTGAAATGGGCGCCGCCTCGGCCCCGAAAGACCCTGTGCTCTTCCTCAAGCCCACCAGCAGGTAACAATAC
TGTCCATATACTTTCTGATGAAGACGATATACCATAATTAACGATGCAACTGCGATCGAATAGCTACGTGCGCAACGGAGGTAGTGTGCTGCTGCCCCCT
GGAATCGGTGAAGTGCACCACGAAGTGGAGCTTGGTGTACGTCCATCTACTCAGTATTAAGGAATGGGAGTGCTAACTACTTTGTTGTGTCTTGCAGGTG
GTGATTGGCACGGATGGCAAGGATATCGCCGAGAGCGAGAGCATGGACCACGTGGCTGGATACGTAAGTTTCACCCACTCTGTTTGACGTTTCTGTAACT
TGTACTGACACTTTAGCATTGTTTGACAGGTGTTGGCGATCGACATGACGGCACGTGATCTGCAGGCAAAGGCCAAGAAGGCCGGACTGCCGTGGACGCA
CGCCAAGGGGCTGGACACCTTCACGCCCATCAGCGACTTCATCCCCAAGTCAGCGGTGCCGTCGCCCCATGACCTGAACCTCTGGCTGAAGGTGGACGAC
GAACTCCGTCAGAATGGCAACACGAGCGACATGGTGCACAATATTCCGTTCCTGATCTCCTATGTGAGCCGCATCATGACACTGGAGGAAGGCGACCTCA
TCATCACCGGAACTCCGGAAGGAGTTGGCCCAGTGCCGACTGGCAGCGTACGTTTCTGTAGACAGACATTACCTTTTTGTTATTTTATCTAAACATCTCT
ACTGTCGCGTGACTGGTAGGTGCTTACGGCGGGCATTACTGGACTCATCGACGTGCGTTTCCCCGTGGAAACGCGCGTGTACAAGGCGTA