Transcript Name :
Phypl_g46
Orientation:
(-)
Number of Exons:
7
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
HECT57.746PS50237
HECT57.746PS50237
HECT57.653PS50237
HECT57.653PS50237
HmmSmart predictionP-Valprediction_id
Zinc finger, RanBP2-type0.56SM00547
Zinc finger, RanBP2-type0.56SM00547
HECT5.4e-39SM00119
HECT5.4e-39SM00119
Zinc finger, RanBP2-type0.15SM00547
Zinc finger, RanBP2-type0.15SM00547
HECT1.6e-30SM00119
HECT1.6e-30SM00119
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.4660.68626
InsideOutsideTMhelix
1-4
5-24
25-368
369-391
392-991
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
zinc ion bindingGO:0008270IEA
ubiquitin-protein transferase activityGO:0004842IEA
*** None ***
*** None ***
Sequence
        5104 bases(100 bases per row)
TGTCTGTAGGCGGAACCATCGCTGCAGCGTGTGCGCTAGGGCTGCTTCTAGCTCTGTTCTTCGGTTGGCTGGCGCGACGGTCGTTCAAGAAATTCGAGCG
CGAGGCAGAGCTCAACGCGCCGCTCATCAAGTGCGTACCGGCAAAATACCCGCTAACCATCAACCAGTTCTGTATCTTGGAGTGTTTAACGATTACTGAT
CGCTCCATTGTCTTGCAGTTCCGAGGATCGACGTCTGGATGCGGCGCTAAGGTCGGTCTCCCGTATAAGCTTATTGGGTAGTGCATGTATTTGCAAAGAC
TGACGTTGTTCATTGTCGTTTTCATCCAGGGATGCAGAGGAAGGATACAACAAGTGCCCTGTGTGTGAGTTTGAGAACTTTAAGCGCTTCCGGTTCTGTA
CGATCTGTGGGCAAGAAATTGTGGAGACGGAGGGCAACGGTGACCAACAAGGCCCAGGAGCTACAAAGAAAAAGAAGAAGATTCTATCGATCTCGGCCGT
CTTCAAACGAGAGAAGCACGTCAAGTTGACCTCTACCTCCTCTACGGTGATACGCTCGAAGCAAACTTCTTGCCGCAGCGTACGGGCTCAGCGACGTAAG
GAATGGATGCGCAAATTGGACGTCGAAGGGCGAGCGTATTGGTTTCGTGATAGCCGCTTCGTGAAGACCGATGTTATGCCTGCAGCTTTTGCTGTTTCGT
TTGAACCTGCAAGTACTGGGCCCAACTTGCTTCGACAACTTTCCGCATCTCAGGAAAAAGACAGCATGGCGTCCGAGGTAGCACCCAGCGATACAGCTCA
AGCGATGCCAGTACCTGCAGACTCCTCGAATGAAAGTGGCGATGTCTCAAGTCCCGATGCTGTCGAACCCAACCCGGAACTTGGGCATTCAAGTAGTCAG
GCACAACGGAGATCTACGTTTGGTTCAGTTGAGAGGTGCATGGCCAATTTGAAGAACGGCGTCCAGGAGTTGAAGTCAGTGCTAATACCAGTGTCGGATA
TCCGGGTGGATGCTTTAAGTCTCCCCCTTAGAGTCCCCATTGCCCCAGTCCGGCACACACCCTCCTCTGCTCCAGATGAAAACGGTGTAGCTTTGGCCGA
GTTGATGTCTTTTGCAAGCAAAGACTTTCCCTCGAAGTATGCACATTTCGTCATGACCGCTTCAAGTCTGCTGGTACCTGCCGAAAGAGAACATCTGCGG
CTCAATATTGAGCGTGCTACAGTGTTCCAGGACTCCATGGAGTCTCTCGCCTTAATTCCTCTCCGCAATTTGCATTCTGTGATGCGAATTAACTTCCTGG
ACGAAAGCGGAATTGACGCTGGAGGCCTTCAGCGCGAGTGGTTCGTGATGCTGAACGAGATACTCGTGGATCCGGCTCGAGGGCTTTTCGTGTGCGCTAA
CCAGAGCGAGCAAACCTATTTCCTAAGCCCCTGCACCGATTCCGACGAATTTCCTCACCAGCTACTCCATCTATCAGCAGCCGGCCGTCTACTTGGCCGA
GCGTTACTGGAAGGCTCAATGCTGTGTTTCCATTTGGCCCCGCCGCTGTTAAAGCTCATTTTGGGTTATCCATTGAGTTTTGCGGATCTCGAGAACTTTG
ATCCGGAGGTGTATACCAATTTGCGTTGGCTACTGGAGAATGACAACGTGGGGTCTTTGGGTCTCGATTTCAGTGTGACTGTCAAGGATGGGGAAAGCTA
CCGAACGATTGAGCTGGTACCAGGTGGAAGCGACATCTCCGTCGTTGACAGCAACAAACACGAGTATGTCGAGCGCAGGTGGCAGTATTTGCTGGTTGGG
AGTGTGGCACCCCAGCTGCAAGTGTTTCTCCAAGGCTTGTACGAGGTAATCCCTCGCGAACTTCTGCTGCTCTTTGATCCGGAGGAATTCGACTTTCTGC
TTTGTGGCTCGGAAGAAATCGATGTGGAGGACTGGGAGCAGCACACGATGCACTCGGAAGGACTGCATCACCATCGATCCCTCAAGTGGTTCTGGGAGCT
GGTCCGTGAGATGCCAAACGAATATCGTCGGCGGCTACTCCAATTTGCTACAGGTTCTTCACGGGTGCCGTTGTGTGGCTTTGCTGCTCTCACAAGTTAC
GACGGCCGTTTGTGTCCATTCTCTCTCAAGTCTGTTCCGCTTGTAAGTGATGGATTTATCCACAGCCACGCTTGCTTCAACCGGTTAGACCTGCCGCTCC
ACGTGGTTCGAGACGAACTAAAGGCTGTGCTGTATGCGATGTTGGAGACCGAAGTGTACGGCTTCACGACGGTTTGACAGTGTTGAATTGAATAAAAACA
AACACTTCTTTTATGTTGTTTCCAGTTAGTGGCTCGACTGGCAAAAGCGTGTTGACCTACGCTAGTTGCATCGAGTAATCACACGGGCCGCATCAACAAC
TTTACAGTGCAAAAAGCGACACACTCATCCGCTGTGCCGCCTACCTCCTCAAAACTATTCGCTCGCAGGGCTAAAACATATGTGAAACTTTAAGTAATTT
GTACCTATGGTAAAGGCTCTATTGAATGACTGTACCGTGTGGTACTACGTCTCAGTCACTGCTTGACGGACGCCATTGCAGATTTAGACCGCCGACACGC
CATGCAGGCCGTGCTGGGCTCCCTCGTGGTGCTGGCCATCATCGCGCTGCTCCTCTTCTTCCTGTCGATGCTGGCCAGACGCGCGTACATGCGCCGCCAG
CGCTCGCTGGAGCTGCACGCGCCTCTGCTCAAGTGCGCCACACGTCACAGACTTTCACTGGACTTCTATAAAAAAAATACCAACATTTTATTTTATTTTA
CTGCAGCTCGGACGACCGTCGCCTGGATGCAGCACTGAGAGACGCTGAGGAAGGATTCAACGTGTGTTCGGTCTGCAGTTTCGAGAACTTCAAGCGCTTC
AAGTTTTGCACAGTCTGCGGAGAGGCCATCGTGAGTGGCGACGAGAACGCAGATACAAGCAAGAAACGAGCGACACGACTGTCGTTCTTGCCGCTATTCA
AGCGAGAAAAGAGTAGAGTGGAGCTGGTCACACCCTCTCCGCCTAAAAAATCCACTCGTCGACGTCTACGGGCGGAACGAAGGAAGGAATGGACGAGGAA
AGTGGATGTGGAAGGTCGGGTCTACTGGTTCAGAGATGGCAGGTGGGGAGACACGCAGTTTGCTGGATTCGTTGCGCAGTTCCTATCTAAAAATGTGTCG
GATACAGATACAAAGTCGACTTTAGCTCAACACGATGAGGGAGCTACGAAAGGAGAGCCGTCGTACAAAGCAGAGGAGACTTTCGAACCTTCACAACACC
CGGCAGGTTGTGACTCTAATGGGTCAGTGGACGGAATCACTACGTCCTCTGTTGGAATAGACATTTCCGAGCCGGAACCAGAGCAAGAGAACAATGGGGA
CGAAAATGCTGATGGTATCGAGCAAGATAGTGCCCAGCAACCTGTGGTCGGATCAGTTGAAGATTGCATTACCACCTTGGTGCGGTACACCCAAGATCAG
CGCGTTATGCTTGCGCCGTCGTCTGACAAAGCCGTGGATGCCTCGAAGCTGCCACTTGACGGTGGCATTGGCCCAAATGACCAAAGTAGCACACCACTAA
CGGAGACGCTGGCACTTGCTGCAAAAGATTTCCCATCCAAGTACGCCCACTTCGTCACTGCAACGTCGGCGCTGCTTGTTCCTGCAGAGAGGGAGCACTT
GCGGCTCAATGTAGAGCGCGTTAATGTGTTTGAAGACTCAATGGAGTCGTTGGCTATCATCCCCCTCGAGAATGTGCACTCGGTACTCCGCATTAACTTC
TTGGACGAGAGCGGAGTCGATGCTGGTGGGTTGCATCGTGAGTGGTTTGTGCTACTGAATGAAATGCTCGTGGATCCTGTACGGATGCTGTTCGTGTGCA
CCAACAAGAGCGAGCAGACCTACTTCCTGAGTCCGTGCTCCAATGCGGACTTCTTGCCGGATCAATTGTTGCATCTGTATGCAGCTGGCCGTCTACTGGG
TCGTGCGCTGCTCGAAGGATCCATGCTGTGCTTTCATCTTGCGCCGCCCCTGCTAAAGCTGATACTAGGCCACCCGCTATGCTTTGCAGACGTGGAAGAC
TTCGACCCAGAAGTGTATACGAATCTGCGTTGGCTACTCGACAATGACAATGCCGAGTCACTTGGACTCTTCTTCACCGTGACCGTGAAGAATGGAAAGA
AATACTCTGATATCGAACTCGTTCCCGGTGGAAGCTTAATGGCCGTCACCGACACAAACAAGCGGGAGTATGTGGAGCGGAAGTGGCAGTATCTGCTGGT
GGAAAGTGTGGCACCGCAATTGCAAGTATTTCTCCGTGGTCTGTATGAAATCGTCCCTCGCGAGCTGCTGCTCCTTTTCGACCCCGAGGAGTTCGACTTC
CTGTTGTGCGGGTCCGACGAGATCGACGTCGATGACTGGGAGCGCAACACCAAGTACTCGGAAGATCTGCACCATCATCGGTCGTTGGTTTGGTTCTGGG
AGCTGGTGCGCGAGATGCCGAACGAATACCGTCGACGATTACTTCAGTTTTCCACCGGTTCATCGCGTGTGCCCTTGGGTGGATTTAGTGCCTTGACGAG
CTACGACGGTCGCTTATGCCCATTTACACTGAAAGCCGTGTCACTTGTTGGTGGCGGATTCATTCATAGTCACGCTTGCTTCAACCGTCTCGATCTCCCG
CTTCATGTTGTGCGGAACGAGTTAAAGGCTGTGCTCTACGCGATGCTGGAAACGGAGGTGTACGGATTCACAACGGATTGACGCGTTAACTGTGCTAATA
AAGTGTTCATTATTCGGTACGCGCGAGTATTAATACTCGCCATGAATCTGCTGGATGAATGGATGCAGGCGGCAGGAGACAATGATCTTGAGCTTGTCAT
GAGCTTGTACAGCGATAATTCGGATCTGCTAGACCAAAGACACCCTCACACTGGTCGCACAGCACTGCAACATGCGTCTGCTTGGAATGCCCACGACGTT
GTGGGCTTTCTTCTTCAGTAAGTACTTCAGGAAGCAGTTCTGGATTCGGTGGAATTGAAGTACTGTTTGATGTGCTTGTAGACGTGGAGCTGGCGTTCTT
GTGA