Transcript Name :
Phypl_g43
Orientation:
(-)
Number of Exons:
1
Description :
succinate semialdehyde dehydrogenase, mitochondrial precursor
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.1520.20918
InsideOutsideTMhelix
1-511
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1535 bases(100 bases per row)
TGCTTTCGTCCAAGATCCACCGCTCCGTCCTGCCCAGCGCCGCCTCGGCCTCGCGCCGCTTCTTCCACGCTGAGGTGCACAACAAGGAGCTGATCCAGTC
CGCGGGCTTCATCAACGGCAAGTGGGTCGAGGCCCACTCCAACAAGCACTTCGCCGTCATGGACCCGTCGACCGACAAGGAGATCGCGCGCGTTGCCAAC
ATGGGGCGCGTGGAGACTCATGAGGCCATCGCGGCGGCTCTGGCGGCCCAGAAGAAGTGGCGCAAGACCACACCCGCGGCCCGTTCCGTCTTGCTCAAGA
AGTGGCACGCTGCCATTGTGGCCAACACGGAAGATCTGGCCGTCATCGCCTCCGTGGAGAGCGGGAAGCCTCTTCCGGAAGCCAAGGGCGAAGTGGCCTA
CGCCGCCGGCTTCATCGACTTCTACGCGCATGAGATCATGCACTCGAGCGGCTTTATGCCCTCCACCTCAGCTGTGGACCACAAGATCATGGCAATCAAG
GAGCCCGTGGGTGTCTGTGGCATTGTCACGCCCTGGAACTTTCCCCTGGCTATGATCACTCGCAAACTTGGCCCTTGTTTGGCTGCTGGGTGCACCGCTG
TGGTGAAGCCTGCAGCCGAGACGCCACTGTCTGCTTTGGCGCTGGCTAAGCTGGCCGATGATGTCGGTATCCCGGCCGGCGTCATTAACGTGGTGCCGTC
CCCTAACGACAAGGCTGCTGAAGTGGGAGGAGCTCTGACTAGCAGCCACGACGTCCGCAAAATCTCGTTCACCGGTTCGACTCGTGTGGGCAAATTGCTG
ATGGAGCAATCGGCCGAGACCGTGAAGCGCGTGTCGCTAGAGCTCGGTGGCAACGCGCCGTTCATTGTGTTCGAAGACGCCGACCTGGACAAGGCCCTGG
ACGGGCTCATGGCCTCCAAGTTCCGCAACACTGGCCAGACGTGCGTGTGCAGCAACCGCATCTTCATCCACGCCAGTATCTACGACGAGTTCGCCGCCAA
GCTCGTGGAACGTGTCAAGAAGCTCAAGATGGGTCCACCACGCGAGGAAGGAGTGAACCTCGGCCCACTGATTGGCCCCAATGCGTTCTTGAAGACCTCG
GAGCTGGTGGAGGACGCTGTCACGAACGGCGCGACGGCTCTGGTTGGTGGCAAGCGCAGCGACATTGGCCGCAACTTCTACGAGGCTACGGTGCTGGCTC
ATGTTGACGACACGATGCGCGTCTGGAGCGAGGAGATCTTCGGGCCCGTTGTGCCGCTCTTCAAGTTTTCTACTGAGGAGGAGGTGATCGAGATGGCCAA
CGGCACGGAGGCCGGTCTGGCCGGGTACTTCTTCTCGCAGAACCTGTCGCGCACGTGGCGCGTTGCATCTGCACTGGACTGCGGTATGATTGGAGTGAAC
ACTGGCGTCATCTCGAACGTGCAGGCTCCGTTCGGAGGTGTGAAGCAGTCCGGACTGGGACGTGAAGGCTCGTTCATGGGTCTGGAGGAGTACCAGGAGA
CGAAGATGGTGTGCGTGGGCGGACTAGAGCAGTAA