Transcript Name :
Phypl_g23
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_495212
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Myb domain22.034PS51294
Myb domain22.034PS51294
Myb domain14.147PS51294
Myb domain14.147PS51294
HmmSmart predictionP-Valprediction_id
SANT/Myb domain0.0000000000000052SM00717
SANT/Myb domain0.0000000000000052SM00717
SANT/Myb domain0.00000000002SM00717
SANT/Myb domain0.00000000002SM00717
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Myb domainIPR017930
Y-scoreD-scoreY-pos
0.080.0643
InsideOutsideTMhelix
1-766
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
chromatin bindingGO:0003682IEA
*** None ***
*** None ***
Sequence
        2300 bases(100 bases per row)
TGCGGATCATGATCAAGGGCGGCGTGTGGAAGAACACGGAGGATGAGATCCTCAAGGCGGCCGTGATGAAGTACGGCATGAACCAGTGGGCGCGTGTGGC
TTCTTTACTGGCTCGCAAGTCGGCCAAACAGTGCAAGGCTCGCTGGTACGAGTGGCTGGACCCGAGTATTAAGAAGACGGAGTGGAGTCGCGAGGAGGAA
GAGAAACTACTGCATCTAGCCAAGCTCATGCCCTCCCAGTGGCGTACGATTGCCCCCATCGTCGGTCGCACAGCTGCGCAATGTATGGAGCACTACGAGA
GGCTGCTGGACGCCGCCCAACAGAAAGAGGGGGTGGAAGTTAGCGATGATCCGAGACGGCTACGTCCAGGAGAGATTGATCCCAATCCGGAGAATAAACC
GGCACGTCCCGACCCTGTGGACATGGATGAAGACGAGAAGGAGATGCTGTCCGAAGCGAGGGCACGTCTGGCCAATACGAAGGGCAAGAAAGCCAAGCGT
AAAGCTCGTGAGAAACAGTTGGAAGAGGCTAGACGTCTCGCTGCATTGCAGAAGAAACGGGAGTTGAAGGCTGCGGGCATCATGTCGTCTAACCCGAAAG
TGCAGATGAAAAAACGCAAGTTCATCGACTATTCCAGTGAGATTCCGTTCGAGAAGAAAGCCCCCGCTGGGTTCTATGATGTGACGGAGGAGAAACGTAT
TTCCAGTAAGGGGCTGGATCCGAAGTGTGCAGTGCTGCAACTGGACAAGCTGGAGGGAGTGCGTCGTGATGCTCAAGAGAAGAAGGAGCGCAAGCAAGAT
GCCAAGAGGCAGAAATCGCTCATGAAATCCAACCTACCACAGGTTATCGCTGCCGTAAATGCGAAGAATGACCCCATCAACGCGATTAAGCGCACTGCAC
TGGAGCTGCCTGCTCCTGTGGTATCCAATGACGAGTTGAGCGACCTTGCCAAGCTAGGGATGCATGCCACTCATGCAGCTGCTCTTGCTCTTGAGAACGG
ATCAGCCACCGAGACACGTGCGCTCATGGGCGACTACAGTGCTACTCCGCTGCAGTCCAACACTGGAGGTACATCGGCAACGCCTTCAAGTCGCGACGTT
CACGACAATATTATGCAGGAAACGGCGAACCTTTTGGCCATGAGAAACAGTGCCACCCCTCTCCTTGGTGGTGAGAATGTCGAACTGTACGAAGGAACAG
GTTACGCAGGTGCTACTCCATCTCGGACCCCGTCGTCAGTTGTATCTGGCTCAGCAAACGACAAGACGCCAATGTCCGCTACGCGTACACCTCTGCGCGA
CGAGCTAGGCATCAACCCTGAACAGCTTTACGGCACAGAGGTCGAGAACGCCAAGGCAGAAAAAGCTCGGGCAAAGCAGTTGGCTGCTAGCCTGCGTAAG
GGATTCGATAGTTTGCCAGTGCCCCAGAACGAATATGAAATTAACGTCCCGGAGAAAGAGGAGGCAGATGATGATCGCGCGACTGCTCTTCGTGAAGAAG
ACGCTGGAGAGCGCGAAGCTCGTGAGCAACAGCAACGTGAGCTGGAACGAGAGCGTGAACTCAAGCGACGGTCGACTGCTGTGCAAAAGGGGCTCCCTCG
TCCGTCGAAGGTGAAGAAGATGCTGATTCACAGTGAAGTTGGTGAGGTCGCAGACGAGATGCACCAAATGCTGGAGCACGATATCGCCATGTACCCCGTG
GATGACGGAAAGATAAAGAAAAGCAAGAAGCGCAAGAAATCTCCAGCTTCTGGAGTTGTCGACCTGCAACAGTTCTCGGACAAAGAAATAGAGCGCGCGC
GGCAAATGGTGCACATTGAGGCCAGTCTAAGCGGTGTGAACAACATTTGGAAGGCCCAGAACACGGCAGCTCTTGGTGCGAAGTGGGATGAAGTGCAAAC
TCGCTATTTAAGCAAGGCTGAAGGGAAGAGTGCTGGCGTGTCTTTCCAGTTCGCTACGTCTGACGAGGACAAGCTGCGTGCCGCTCAAGCTCGTTTCACG
GAGCTAAAGGAGACTGAGCAGTTCCTTACGAAGCGTGCACAGAAGCTAGATGAGCGCGCGCGGGTTGTGAATGGGGGATTCTATCGTCGCTCACAGCAAG
GGCTGGAGCTGCTTCATGAACACATGACCGAGCTGCAGAACGCTGCGATCGAGCGAGCCTGCTTCGAGAATCTGTCAAGTCTTGAGAACCAGGCATTGCA
GAGCCGCATGGCTCGACTGGCAAACGATGTGAACTCACAACAACTCGTCGAGGTAAAGTTGCAGAAGCAGTATGCGGCGTTGTCCCTAGAGCAGTCGTAG