Transcript Name :
Phypl_g32
Orientation:
(-)
Number of Exons:
3
Description :
RING-box protein 1
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, RING-type9.303PS50089
Zinc finger, RING-type9.303PS50089
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0520.05346
InsideOutsideTMhelix
1-111
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
zinc ion bindingGO:0008270IEA
*** None ***
*** None ***
Sequence
        478 bases(100 bases per row)
TGGACGAGGAGATGAAGAGCGCGACGACGACGGAGGTGGTGCCGGCTGCGGCCTCCAGTGAGGAGAAGCGCTTTGAGATCAAGAAGTGGAACGCTGTGGC
GCTCTGGTCCTGGGGTGAGATGCTATCTCCACTGGCCAGTCGAGATCTTTTAGTGAACTAAATGGTTTGGTTCCTTATTTCTTTGTTGCACAGATATCGT
GGTGGATAATTGTGCCATCTGCCGTAACCACATCATGGATCTGTGCATCGAGTGCCAGGCAAACCAGGCTTCGGCCACCAGCGAGGAGTGCACAGTGGCT
TGGGGCGTCTGCAGTACGTCGAATTGGGTTGATAGCATTTTTATACCTTACTAATCCTGCTGTATTATTTACTACAGACCACGCATTCCACTTCCACTGT
ATCTCGCGATGGCTCAAGACCCGTCAAGTGTGTCCGCTGGACAACCGTGAATGGGAGTTCCAGAAGTACGGAAGATAA