Transcript Name :
Phypl_g12
Orientation:
(-)
Number of Exons:
2
Description :
hypothetical protein PHYSODRAFT_313194
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0790.07632
InsideOutsideTMhelix
1-147
NN-scoreoddsWeighted Score
0.591.2720.003
*** None ***
TypeScore
cytoplasmic52.2
GO
*** None ***
*** None ***
*** None ***
Sequence
        519 bases(100 bases per row)
TGAAATCCATCGCCGAGGCACTGCGCAAGACTGGGTTTCACAATGTTGAGACGTTCCTTGCAAGTGGGAACGTCATCTTTGACGCACCTGCTATCCCGGA
AGGAGACACACCCGCAGTATTCACCACCGAACTCCGAGTCGAAGAAGCGCTTGAGAAACTCTTTGGCTGTCACATTCCGGTGATTGCTCGCTGCATGGAA
GATGTGGCTGCACTGAGTGAACAGGCCGTGAAGACCGCTACGGCTGTGAACGTGGTGCTGGTGAAGGAAGAACTGACCAAGGAGCAACGAGATATCGTCT
CAGCTCTCTCCACTGACGCTGACGAGCTCGAACTTCTGGACAAAGCTTTTGTATGGTACTCCGCCACCAAGATGAGCGAGTCTCCGCTGTTCAAAGTGGC
CTTCGACAAGAAACTGGGTGTGCCAGTCACAGTTCGAACAGCGAACACCTTGCGCCGAATTGTAGCGAAGTTTAGCTAGCTTTGTTATTGTTGTGGTGTT
TTGGTAGACGGTGAAGTAA