Transcript Name :
Phypl_g44
Orientation:
(+)
Number of Exons:
5
Description :
hypothetical protein PHYSODRAFT_350602
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Flavodoxin4.5e-17PR00369
Flavodoxin4.5e-17PR00369
Flavodoxin4.5e-17PR00369
Flavodoxin4.5e-17PR00369
Flavodoxin4.5e-17PR00369
Flavodoxin4.5e-17PR00369
Flavodoxin4.5e-17PR00369
Flavodoxin4.5e-17PR00369
Flavoprotein pyridine nucleotide cytochrome reductase7.3e-19PR00371
Flavoprotein pyridine nucleotide cytochrome reductase7.3e-19PR00371
Flavoprotein pyridine nucleotide cytochrome reductase7.3e-19PR00371
Flavoprotein pyridine nucleotide cytochrome reductase7.3e-19PR00371
Flavoprotein pyridine nucleotide cytochrome reductase7.3e-19PR00371
Flavoprotein pyridine nucleotide cytochrome reductase7.3e-19PR00371
Flavoprotein pyridine nucleotide cytochrome reductase7.3e-19PR00371
Flavoprotein pyridine nucleotide cytochrome reductase7.3e-19PR00371
Flavoprotein pyridine nucleotide cytochrome reductase7.3e-19PR00371
Flavoprotein pyridine nucleotide cytochrome reductase7.3e-19PR00371
Flavoprotein pyridine nucleotide cytochrome reductase7.3e-19PR00371
Flavoprotein pyridine nucleotide cytochrome reductase7.3e-19PR00371
Flavoprotein pyridine nucleotide cytochrome reductase7.3e-19PR00371
Flavoprotein pyridine nucleotide cytochrome reductase7.3e-19PR00371
Profile scan predictionP-Valprediction_id
Flavodoxin/nitric oxide synthase26.717PS50902
Flavodoxin/nitric oxide synthase26.717PS50902
Ferredoxin reductase-type FAD-binding domain13.184PS51384
Ferredoxin reductase-type FAD-binding domain13.184PS51384
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.1040.13921
InsideOutsideTMhelix
1-619
*** None ***
PositionContextScore
612TLARKKR|YV0.833
*** None ***
GO
Biological ProcessGO IDPrediction Method
oxidoreductase activityGO:0016491IEA
iron ion bindingGO:0005506IEA
*** None ***
*** None ***
Sequence
        2158 bases(100 bases per row)
ATGGCAGCGCCTTCGACGCCGCGGATGCTGGTGCTCTACGGCAGCGAGACCGGCACAGCGCAGGACGTGGCCGAGTTCATCCAGCAGCGCGCCTTCAACA
GGCATCTGCTGGACACGCAGGTATCGGCCATGGACGACTTCCCCGTGGCGCAGCGACTTCCTCAATGCTCCACCGTCGTGTTCGTGGTATCCACGACTGG
CGACGGCGAGGCGCCCGAGAATATGCGCAACAGCTGGCGCAGTCTGTTGCGGAAGACGCTTGGGGCTCAGTGGCTCGCAGGAGTCCGCGTCGCTGTCTTC
GGGCTGGGCGATTCCAGTTACGCCAAGTACAACGCCGTTGCTAGACGTCTGCAGGCTCGGTTACTGCAGCTCGGAGCCTCGGAACTCATCGACCGAGGAC
TCGGAGACGACCAGCACGCTTACGGATACTTTGGCGCCTTGAATCCGTGGCTGGAGAAGTTCTGGACGGCAGTTCTGCAGCGATATCCGCTGCCTGTGGG
TGTAGAAATTGACGACTCGCCGAAGCCTCTCGAACCCCGTTACTCCGTCATTGTGCACGACGCTGCAGCTAAAGAAGTGCACGAGGCGAAGGCTTTGACA
CCAAGAACCGACGAATCGAATTTCTATGCTCCGCCACGCACTGTGGTGGGACGTGAGAAGGGAATCTACTTCGCTCCGGTCGTCGTAAACAACCGAATTA
CGGCTGAGGACTGGGAGCAGGATGTGAGGCACTTGGAGTTTGATATCAGTGACGGGTCGAGTGCTAAGCCTATTGAACCTCCGTTCCGAGCTGGAGACAT
TGCTGTAGTGTACCCCGAGAATGTGGCGAGCGTGGACGATATGCTCAAGTACGTGAAGATGGACGGAGACACTGTCATCTCGATCAACGCTGCCGACGGC
TCCAAGCAGCTCGATTTGCCTTCGCCGATTACTGTTCGTGATTTGTTCACCAAGTATCTCGCCATTCTGGAAATCCCGCGCCGAAGCTTCTTCGAGAGAC
TCTCCCTGCTCGCGTCAAATGAAGAGGAGGTGCGTTTCAATATCTGCTACTGGTTTCTAGACATAATAGTGAAACACTAACGTCGAATTCCTGTTGATGC
TGGCTACGTAGAAAGAGAAACTGGAGGAGCTCGCTTCGGCTGAGGGTGTAGACCTGCTTTACGACTACTGCATCCGTGAGAAGAAGACTTACGCTGAAGT
ACTACCGGACTTCCCGAGCGTGGACGTATCCTTGACTATCCTGGTGCAGCTCATTCCTCGCCAACAGCCCCGGTCGTACTCCATCTCATCATCAGCCCTC
CTCCACCCTGGAAGGGTAAGATATTGTGTGTTTTGTACTGGTTCAAGCTGCGTTCTTACCAAACTTTCTTCTTTTCTTACGTCTTAGGTGCATTTGACGG
TGGCCATCGTGGATTTCTTGACGCCGTACAAGCGCCGTCGTTTCGGAATTTGCTCGTCGTTTTTCCAATCGTTGGCTCCCTCCAAGGAGCAGAAGATGGT
GCCAATGTGGATCAAGAAGGGGCTTTTTGAGCCACCCGCTTTAGTGCGCGATGTGCTACTCATCGGACCTGGCACGGGTCTTGCCAGCATGCGAGCGATG
CTACAGGAGCGTCAATTCCTGCGCAAACAAGCTGGTGGTAACAACTCAGGGACGACGCATCTCTACTTTGGATGCCGTCACGAAAGCAAGGTGTGGAGTC
TACCACTGCAGTGTTGGGAATGACTTTATAGATTCTAACGGTCTTTTGCTGCTTTACAGGACTTTCTCTACGGTGACGAGTTGCGTGGACTCGTAGCCTC
TGGCGACCTCACGGAGCTGCACACAGCGTTTTCACGTGACCAGGTACGCATCTCTCGTTTTGCAGTCGTTTCACTCTCATTTGCCTTAAAACCTATTATC
ATGGTTGTCACGCCCACAGGACCACAAGATCTACGTGCAGACGCGACTGGCAGAGAACAAGGAGGCTGTATTCGACTTCATTACGAATGGCGAGGGCTGC
ATTTACATCGCCGGGTCCGCCAAGCGAATGCCAAACGACGTCTACGAGGTTCTACGTGACATCCTCCGCTCGGTAGGGAAAATCCCACTACCAACCGCCG
AGAAGGTCATGAAGACGCTGGCCCGCAAGAAGCGCTACGTCGTGGAGTCCTGGTCGTA