Transcript Name :
Phypl_g7
Orientation:
(-)
Number of Exons:
5
Description :
hypothetical protein PHYSODRAFT_313188
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Small GTPase superfamily, ARF/SAR type6.5e-20PR00328
Small GTPase superfamily, ARF/SAR type6.5e-20PR00328
Small GTPase superfamily, ARF/SAR type6.5e-20PR00328
Small GTPase superfamily, ARF/SAR type6.5e-20PR00328
Small GTPase superfamily, ARF/SAR type6.5e-20PR00328
Small GTPase superfamily, ARF/SAR type6.5e-20PR00328
Small GTPase superfamily, ARF/SAR type6.5e-20PR00328
Small GTPase superfamily, ARF/SAR type6.5e-20PR00328
Profile scan predictionP-Valprediction_id
Small GTPase superfamily, ARF type22.657PS51417
Small GTPase superfamily, ARF type22.657PS51417
HmmSmart predictionP-Valprediction_id
Small GTPase superfamily, ARF type0SM00177
Small GTPase superfamily, ARF type0SM00177
Small GTPase superfamily, SAR1-type9.4e-27SM00178
Small GTPase superfamily, SAR1-type9.4e-27SM00178
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.040.04834
InsideOutsideTMhelix
1-186
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
GTP bindingGO:0005525IEA
intracellularGO:0005622IEA
intracellular protein transportGO:0006886IEA
small GTPase mediated signal transductionGO:0007264IEA
*** None ***
*** None ***
Sequence
        817 bases(100 bases per row)
TGGGACTGCTGAGTATCCTGAAGAAGGTCAAGGAAAAGGAGAAGGAGGTCCGCGTTCTCATGCTGTGCGTCCCTCTCTCTTTCTCTTTGTCCGCCATTAC
GTTGACTGGAGCTGACGAGTTTATTTGCCTCAGAGGCCTGGACAATGCCGGCAAGACAACGATCCTTAAGAAATTCATGGGCCAAGACATCACGGAGATT
TCGCCCACGCTGGGCTTCGATATCCAGACGCTCGAGTATAAGGAGTGAGTGTGTGCAATTAATTGTTTGTAAACTTGATCTCGGGAGAGACTCACTGCAT
AGCTGTTAGCTTCAAGCTGAATGTTTGGGATGTCGGTGGGCAGCAGACGATTCGCTCGTACTGGAGAAACTACTTCGAGCAGGTCTGCCACTCTGTGCTA
GTATCATTAGGTATATTTGAGCTGATATTATGTGTGCGGGATGGTAGACGGATGGCCTTGTGTGGGTGGTAGACAGCGCCGACCGTCGGAGACTTGAAGA
TTGCAAGCGCGAGCTTTCCAATTTGCTCACTCAAGAGGTGAGTACTAAGCTTAAATGTAGTGATACGTGCATGCTGTTAACTACTGCTCATTCAGAAACT
GGCAGGAGCGACGCTGCTGATCTTCGCCAACAAGCAAGATCTACCTGGCGCTCTCTCCTCTCCAGAGATTGCGGCTGCACTTGGGCTGCAGTCGGCCCAG
TTTTCTACCCGACACTGGAGTATCATCTCCTGTAGCGCCGTCACAGGCGATGGCCTCGTCGACGGCATTGACTGGCTTGTCGGTGATGTGGCGAGCCGGA
TCTTTTTAATGGAATAG