Transcript Name :
Phypl_g28
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0380.06410
InsideOutsideTMhelix
1-627
*** None ***
PositionContextScore
117ERNRKKR|AF0.854
592QRQHVRR|QV0.543
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2137 bases(100 bases per row)
ATGTCGCGGACAGCGCCGTCCCGGGCACTGGATCCCGTCTACGGTGAGTCTCTAGTCGTGGTGGCGCGCCTGAGGTGTTGTAGCTAACGTCTCTCTCCGC
AGATACCGTGTATACTGTGTCGAAATCGGGCGGTTCTTTCCGCAAAGGGGTGTACCGAGCATCTTCAAAGCCTGCGAATACAAGCAGCAGCCTCAACAAC
CAGAACCCAGCAGAGGGCAGCTACCTCGTCAGTGGTAGGGAACGAGTCAAGTTTCATCGAAGGCCAGTGCTGCCTCACCTACAAGCGGAGCCACCTGAAG
TGTTATTAGCTCCAGTTTACGCAGCCTCAAGTTCTCCAGTCAAGCATCGAGATGTGAACGCTTCGACCTCCAACTACGTCTCTGCTTCACTAGTCGACGG
GAGCACGCGGTCGGTGGGTATCCAAACAGCTTATCGGGACTCCGAGACGCAAACCGATCCGTACACGCCCGACTACACCGTGCAGAAGACTGCGACCGGA
GTGACACCCGAGATAGCAACACTTACTGGACTAAGTCATGCTCGTGGACAGCTACCAGTTGGGCAGGCTGAACTGGAACTCATCGAGCGCAACCGGAAGA
AGCGTGCGTTTGAGGCGTCACTGCCACCCATGACTGACGAAGCCAGCTTCCTGCTGCGTAAGGCCATGTTGGAAGCTCAAGAAACTCGCGAGTGGGCGTT
CCGTGAAGCTGAAATCGACGCTTTCCATGATCAACGAGTAGCTTTGCTGGAACAAGCACTTGCAGAGCGTGAGAAGGAGAACGCGTTTCTCTCCGAACAA
CGGCTTGAAGCTGTTCGCCAGCGGCTGCTGCATGAAAAGGAGAATGCACTGGAAGCGATTCAACAAGAGCGTGTGGCAGCGCTGCGTAAGTTGACCAAGA
AGCGAGCTCAGAGGCAGCAGGAACGCGGATTTGGCGCGTCCAAGCCTGAACGGGGACGTGACATCATCGCTGAGTACGCCAACTTCGGCTCACAAGTGTA
CGCTCCTGTAACGCGTGATGGCAAGGCTGGCAAAACGGATGTTCGTGAGCTGGGTATCGGCAAGCCCCAGTTCCTACAACTCGATGCTTTGCGTGAGCTT
GAAAGTGCCGTGCCAGCACGAATGTTACTGCCTGCTGCGGGCAAATACAAGCCTCGCGAGAAGAGTGGGCGTACGGCTAAGGAGCGGAAGCAAGCAGCAA
TCGAAGCTCACCTACTGAAGATGGAGTCCATCATTAAGAAGAACAAGGAACAGAACGACAGCACTGATGGTCAATCTCGTCAGAATACGAGCAGTCCACT
CACACGACGGGCTAGTCAGAAACAACAGCAGCTTGTCCGCCCTCCCACACCTGACTACGCTCTTGCTCACGTTGCAGACTCGCATGAACACGAACTGGAG
GACGCAGTCCGCCTACTACAGAAGCTGTTACGTGGTCGTGCTGTTCAAAACATGATGTTTGAAGGGAAAGAGAGACGTGCTGAGCTTATCGCCGAACTGC
GTGCAGCCGACGAGCAACTGGCACTGCAGCGTCGCCACGAGTTCGAACTTCTGCAGGGATCTGGCACCGAAGGGATCGATCGTGTGGAAACTGCAGCGAA
GACGCGCGTGGAGGGCGAAGTGGTCTCGGAAATGCTCGATTTCCTGTCCAAAGAGCTCTCTCGGTCTCGTGAAGTGGCCAAGATGCGTGCGTTCGTGATC
AAGGCGGACGAACAGCGGCGTGTACGCGAAGTAGAGGAAGGCGGACGACGGCAAGCGGAGGATTTGTTACGAGAACGTGAGGACGAGGTCTTCCGACGTG
TGATGCAGGTGCATGAGGAAACGTCTTGCGACTTCGTGGACGATGTGCTAGAGGAGGTTGTTCTGGAGCAGTCTCACGCCCAAGCGCTCCATGAACTGCA
CGTACGCAGCGCTGGTGTGGACGGGATTGTACTGCAGCTCGAAGACGAACTGGACAGCGACGAAACGGTAGTGCGCGAGCTTGTAGCAAGTTTCTTGCTG
CCTCATGTACAGCGACAACATGTGCGTCGTCAAGTGGCGCAGCAGCAGAGGAAGTATCTGACTGCAGCACACGCGCTTCTCACTGAAATGGCGACTAGTA
TGAGTCAACCGAAGCCAGGTCCAGCGGAAGATGCCTA