Transcript Name :
Phypl_g22
Orientation:
(+)
Number of Exons:
4
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0750.08230
InsideOutsideTMhelix
1-444
NN-scoreoddsWeighted Score
0.7081.2640.003
PositionContextScore
12RRGRGKR|QK0.621
TypeScore
nuclear39.1
GO
*** None ***
*** None ***
*** None ***
Sequence
        1855 bases(100 bases per row)
ATGGTACGCGACACGCGCCGCGGCCGAGGCAAGCGCCAGAAAGCCAGCGCCATCCTGGACGAGTTCACAAGCCTCGACGCGCTGCTGCAGAACGACCTGG
CGGAGAAACGAAAGCGCGAGAACCGACAGCGGAAGATGCAGAAGCTGCGCGAGGAGAGCGAAGCCGCCGAGAAGGACGCGCCGTTGGGAAAGATCATGAG
CAGCATGGACAGCAACATGTCGGCGCTCTCGGGCGATAATTATCTCTTCACGGCCGCAGAGGTGACGGTGACCGAGGAGAAGTTCGGCTACGTTTTCACC
CCCATGACAGAGGTGCGTCACTTGAAACCTTTTTTAATGAGTCGTATTAACTTTTGCTGGATTTGTTGCAGCCACTGCCGTATCACACGTACAAGGCGAC
GGAGAAGGAGTTGCAGAGTGATCTCAAGCTCGTGTACGAGACCATGCAGTCTACGACCGACGAGGAGCTGAGCGGGCTGCTGTGGTCCAAAGCCATTCTG
ATCCGATGCATGCTCAAGCGCAAGAGCGAATCCACCACTAGAGGCTCTGCGATGACGCCCATCGTGCTGCCCTCGAAGATTGGTTCATGGTTATTTATGA
CGAGTACGTTGCAGTTCACTGTTGGAGAGTTTTAGCTTAACGACTGACACTTTCTTTTATGTATAGTGTCAACTCACAGCAACAGTCACGTGGTCGGAGG
ATGTTTCAGCAATCTCTTCCTGATTCAGAGCTCTGCGAAGAAAACTTCCCTGTCGACCCTGGCCTCCGCTCTACCTGTGGCTTGCTTCGCGCACCCGATT
GAGGATTTCGCTTCAGCGTTTGGCACCCAGACTCCTCCCATCGAGATGGAGTGGGAGCCTTCCATCTACGACTTCCTCAACGCTTTCCGCGCGTACGGGT
TCCAGGATAGCAAGCGATCGATGAGTGTGAAAAGCAAGATCCCGGTGACGCCACCGGCATCGAAGAAGACGCGTTTGCTACCGTTTCCGACCATGAATAT
GCACTACGTGCTGATGTACTTGGTGGTTTGTCTGCGCACGAAGACGCTCAAGCTGGAAGGCTACGACGCGTTCAGCTTTACTATGTTTTTCCTTCGAATG
CAATTTGAAAGTAACATACACGCCAGTATCGTCGATCTGGCTACTATCTGCATCGAAGAACTCCTGGACGTATTTCCTCGTGCCGAGTGGCGGAGGGAGT
GGGCACCTCAGCTCGTTCTGCGTATTGCTGGGGCGAATGAAGGCTTATTCGATTCGGCCGCAGGGTGGCTCTCTGTTGCACGCCGACTTCCGCGCACTAT
GCGCGGCACACAACTTACCACAGGATTGGCGATCTACGTTTTGCAGCACAGAATCGACAAAACTCCACAGGAAGGGGTATGTAACGCCAATGTGCTTGGA
TCGAGGTTATACGTACGGCTGTGCTAATGCTTGTTTTCTATGCAGTCTTCGTCTGAGCGGCCTCTGAAATTTCCAATCCAAAGTGGGCTTGTCGTAGATA
TCGTCGCTGGTATCGTGGGGGACTTGACAAGCAAGTACGTGGAGACGCGCAAGACTAGTAAGGAGTCGAAGAAATCGCCGCCGTTTGATCTTCTGTGCAA
GAAGGTGGCATTGATGGACCTTGCACTGCAAGCCTTCCTCAACATTCTCACTCCAAAGGAAATGAAGATTATGCTGGGAAAGCTCGACCAGTTGGCTGAC
GCACACAGATCTACGATGTCGGCGAAATGGCATGAGCTCAAAACTCTGATCAGTCTCATGCACCGGAAGTACTCGCTTGAAAACTTGCGCATCGGACGTG
GCCGAAGCACGTCGCCATCCGCGAAAACGGTGCTGTTCGCTGATGACGACGAGTA