Transcript Name :
Phypl_g33
Orientation:
(-)
Number of Exons:
5
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
GYF14.333PS50829
GYF14.333PS50829
HmmSmart predictionP-Valprediction_id
GYF0.0000000043SM00444
GYF0.0000000043SM00444
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0390.02939
InsideOutsideTMhelix
1-1002
NN-scoreoddsWeighted Score
0.5350.890.002
PositionContextScore
987SNKRGKR|RS0.539
988NKRGKRR|SK0.566
TypeScore
nuclear82.6
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        4389 bases(100 bases per row)
TGGTGGACTACGACTGCGGTTTCGACTTCTGCTACGACTCTGGGAGGAACTTCGATGATAGTGTCGGCGGTGACCTCTACTGTTCGGGCTTGCTTCCTCC
CCGCGGCTTCGGCTGTGACGACTCGGGCGACTGCTGCTGCATCGGCTACGACTTCGACTCCTACGACGCGTGTGCCATTGCGAGCGTCTACCTCGCTCTT
CATCGAGCTATCGCCAAAAACGAGCAGTCACTATCTTCCACCATACAAAACCAATGCATCTTTCGACCTCACATCTACCAAACGTACCTGTGGACGGAAA
GGGTCTTCTGGAGGCGGCGTGCCGTTTAAACGACCTTGAAGACTCGGTGATCTCGACCTATCGCTGTTCTTGTCGCGACGGTGTTTGTGTCTCTTGTGCT
TGTGTTTCTTTTCCCGTTTCTCCCCCTCCTTTCTCTCTGTCTTGGACTTCTTGCGCCGCTTCTCCTCGACCACATCTCGACCGAATTCGTCTTTCCGAAT
CGTTTCCGCAGGACGACGTTCCGTTGAGGGCGACGAGGACGGTTCTGTCTTTCCTGATCCACTTAAGGACGACGACACCTTGCTGTTGTCGCTGTGGAAA
TCCGCTGCACTTGCTGCCAAAAGTTCTTGGACTTTGTCTCTAACATCGTCTGCTGGCGCTTTGGGCTGGATAATCTCACCACTGCATTTGACACACGCGC
ATAAATTTTACCCAAGCAGCCACAACGCGCAGGTTATTAGCACGTGAACATTACGCGTAGAGTGGGCAGACGAAACGCACCGCCAGTTCCGTAGGCCACC
GCCGCTCATTGGTGCTCAATGAATGAAATGCGGAATAAATTTGTTATTTGATCCCGTCCAAATCACAAATCTTTCGTACTTAGCCGCACTCCACAGCACC
ACGGTCGCTCCCCCCACACTCAAAAGAAGGAGCAACCACCAGAGCAAGAGCCACCACCAAGCGAGCACAAGGAGCGACGGCCGCCATGAGCAGCCCCAGC
AATGACGACGACTTCGTCACCATAACCACCAAGCACCGCAAGAAACAACAGGTCGGAGATGCCGCAAGCAAGAAGCCTCCCACGGGGGCCAACAACGGCG
CCAGCAGCAGCAGCAACATCTCGCTCAGACCGCGCACAATGTTCGCCATGAAAGGCCGAGGCCGCACCGAGTCTGAAGGCTCCGCCTACCGCCCGCAATG
GTCCAAGGACGGCGAGGGCTTCGTGTCGTCAGCCTCGGGCGGCCCCACGTCCTTCAAAGACGCGGCCACAAGCGGCGGACAGGGCGACGACCAGCGAGGC
GAGCGCCGAAAGAGCAAAGTACTGCGTTACTCCAAGGAGGAGCTGTTGGCGCTGCATTTCACAACCAGCGAGGCGCCCACGTTCCCTCCTGAGACTTCAG
TGGCCTCTGAGCACAGCCTCCCACCCGTTAGCACGCTGCCTTTTGACTACGAAGAGATCTACAAGCAATGGTCGCTCAACCGCAATCGTGGACGTGGCCG
TGGACGCGGCAATGCGCAGCAGGGAGAACAGGGACGACGTGGGCATCAGGAGCGAGGAGCTCGTGGAGACGAGGCGGACGGAGGCAAGCAAAGAGACGAG
CACCACCGACACAACGAGCGAGACCCGACATGGGAGCGTGGCGCGAGAGTCACGGAAGGAGCCCAAGGAGATGACGTCTGGGACGACGTGCTGGAACCTG
GAGCGGATAGCAATGAAATGGTGCGACGATGTGGAACAAGTTGGAAAAGTATCTTGGTGATCAGAAGGCTGATAAGTGTGAATTGTGCATATTCTAGGAC
CTGTCAAGTATGGCGGAGGCTGCGGAGAAGTTCCGACGAGAGATGGATGCGATGCGAGAGGAGCTTCAGGGCCCGAAGGCCGACTCGGTACGAAAACAAA
AAAAACTGGAGGATACAAAAATTAGCAGATAACTAAGCGATGCTGTTATACTTGATCAGGAGGTGATTAAGGATGATTTGGACGCGTTCGACCAGAAACT
GGAAGATGCTGCGGCTGCTGGACAATTTGATGATAGCGACAATGAAGACGTGCAATGGGATGACCCTGTTCCTGAGGAGCAGCATAACGCCGGCAGTGCT
AACAGTCCATTGAAAGACCACACCACGGACTTGTTGGGCCGTCAGTCAAGTGGGAGCCACTTATTTGATGCGCTGGAGCCGGCTGGCGAACAGCTCGGGC
TCGAAGAGAAGAGTAGGTTGTCCCTGCCCCAAATGCAGGCCGACGAGGGGTTCGGAGGGCTGTCGTCGCTTCGACTGGAAGTGGAGGATGAGTGGTTTTA
CTTGGACCCCCAGGGACTGCAGCAGGGACCGTTTAAGACGGCAGAAATGCGCGAATGGTTTGAGGCGGGATACTTCAAGCCGCATCTGCCGATCCGCTTT
GGTCGCGAGGGCATCTTTACGGCATTAGCGAACCAATTTGCACCTGGACAGCTTCCTTTCGCTGCACCCCCAACGCGTATGGGTGGCCTCGGAGGAATGC
CTATTGATCCTCGCCAGGCTGAGCAACAGCGTATGCTTGAATTGCAGCGCGAGCAGCAGCGTCAACAACAGCAACAGCAGCAAATGATGCAACTCCAGCA
GCAGCAACAACAGCAGCAACGAATGATGCAACTGAACCAAGAAGAGAAGATTCGCATGGAGATGCAACGCCTTGAAATCGCCCGTCAACAACAACAAACG
CAGTTGTACCAGCAACAGCAAATGCTCCAGCACCAACAAGAGCAACAACGACAGCAGCAGCAACAACAGCAGCAACAGCAACAGCAAATGCTCCTGCAAC
AGCAAAGTTCGTGGCAGCGCAGCCAGCGCGAAGGTATCATGAGTGCTCTCGGTATCTTTGGAGGAAATCAAGAACCCAACCTGGCAGGAAACGACAACTT
CAGATCGGATGACATGCAAATTCAGTTCCAATCTGACTACCGTACGCAACATCAGCGTAATCTGCACAGCCAACCGCAGCCCGTTGGCCAAGACTCGATG
TTCCTCAATGATGACGTCCAGAGGCGCGATCAAGCGTTTTGGCCGAATTCCACGCCAGAAATGTCTGGTCTAGATAACGTTACTAGTCCGACAGCACCGG
AATCGACTCAACCTCCTGCACCTCAAAGTCCACCCGCCGCTCCAGCGTGGGGAAGTAGACCGAAGTCCCCCGAGCGCCCGTCACCCGCGCTTCACGATAT
TCAGAACGAAGAGAAGCGACGGGCTGCTGACAAAGCTCGCAAAGATGGCCACAATGTTGCACAGCAGTCGCCACCCAAGGAAGCATCTCCTACTAAATCG
GCCAAGAAGGAGATCAAGACTAGTGGTTCCGAGGAGAAGAAGAAGAGCCCAAGTCCATCGAAGAAGAACGGTAGAAAGGCAGAAAATGCCAAGGCTGAGA
CGAATGCTTGGGCTACTAGTGCGGCATCTGCTACTACATCGAGCAACTCAAAGTCTCTCAAGGACATTCAACAGGAAGAGCGGCGTGAAATGCTGGACAA
AATGGCTGATGACGACGACAGCAACTCCAATCTTGCGCACATGGGAGCGCAGCTGAAGATGATGCTGGGCGTGGCGTCGACGGCGGTAGCTCCGAATGCA
CCCGCAGCTCCTGCTCCAGCCCCAGTAGCCAAGCCAGTTCCAACCCCTGCACCAACTCCAGCTCCTCCCGCAGCAAGTCCCTGGGGCGCACCCGTGGCAG
TGACGAAGGCCTCGACCTCAAAGTCTATGCGTGATATTTTGGCAGAAGAGGAGCGTCTAGCGCATGAGCGCGCCAAGGCTAATGAGAACGCACCTACCAG
CTCGCACTGGATGAACATCGTAGCGGGAAACAAGGTCGCTGCCGCAGCAATCCCCAAGCCATCTCGGTCAGCATTGGGCCCTGTTCCCGCGTCCGTACTG
AAGAGCCGTCAGCAGGCTCGTGCCGCCAATGGTGCTGCAAAGCCTTCCCCTCCGAAGGCTGAGAGCGATGCGTCATTCTGGAACTTTGGAGCAGCGCAGG
CGTCCGATGATGCGTCCGACAGTACTCAAGTGTCCGCCTCGAACGCGTTTGGCTCCAGCAATGTGTCTTCGGAGTTTATGACGTGGGCACTGAAGCAGCT
GAAAACGATCGATAGCAACGCTAACGTGACGTTACTGGAGTACTGCGCGTCGGTTGAAGACCCCGGCGAGATTCGGGAGTACCTTGCGGCATATCTGGGA
TCGACCCCGCGTGTGTCTGCGTTTGCCACCGAGTTTATCCAGAGGAAGAAGACCCAACACAGTGGCAAGAAGTCTCCAGGTCACCAGGACGCCCAGCAGC
GTGCATCCGAGACAGGATCCTCGAACAAGAGAGGAAAACGCCGCTCCAAGGGCCAAAAGATTGATCCGTCACTGCTGTTTGGCAATTAA