Transcript Name :
Phypl_g14
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_313196
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.1660.2127
InsideOutsideTMhelix
1-510
511-528
529-532
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1598 bases(100 bases per row)
TGGTGCACTACCGTAGCACGCGCGGCGGCGTCCGCGGCCTCAGCTTCGAGCAGGCTGTTCTGACTGGTCTGGCAGCCGACCGCGGCCTGCTGGTGCCCGA
GGATGGCGAGTTCCCGACGCTCCCGGCCGACGCGCTGGAGAAGTGGGCGTCGCTGTCATACCAGGAGCTGGCCGTGGAGGTCATGGGCCTTTTCATCGAC
GAGAGCGAGATCTCACGCGCCCAGCTGCGCTCGCTCGTTGCCAAGAGCTACAACTCCACCACGTTCCGCGCCGAGGAGGTGGCGCCCGTGGCCAAGGTTA
CGGACCAGATGCTTGTGCTTGAGCTCTTCCACGGCCCAACGTTCGCCTTCAAGGACATCGCCCTGCAGTTCCTGGGCAACCTCTTTGAGTTCTTCCTGCA
ACGCAAGAACAAGGCGCTGCCTGCTGGTGCCCCTAAGCACCAGATCACGGTCGTGGGAGCCACCTCAGGCGACACGGGCAGCTCCGCCATCTACGGTCTG
CGCGGCAAGGAGAATGTCGAAGTCTTCATTCTCTTCCCTGAGGGTCGCGTGAGCGCCATTCAACAGCGCCAGATGACCACGGTGCTGGACCAAAACATCC
ACAATGTGGCTGTCAAGGGCACGTTCGACGATTGCCAAGCCATTGTCAAGGACCTGTTCGCTGACGCTGACTTCAAGGCCAAGTACCACCTGGGCGCTGT
TAACTCGATCAACTTCGCCCGCATCCTGGCGCAGATTGTCTACTACGTGTGGGCTTACTTCCGTGCTCGCGAGCAGGGCGTGACCGGTGAGGTTGCCTTC
TCCGTCCCCACGGGCAACTTCGGCGACATCCTTGCCGGTTTCTACGCCAAGAAGCTGGGCGTGCCCATTGGCAAGCTGATCGTGGCTACCAACGAGAACG
ACATCCTCGACCGCTTCTTCTCCACGGGCAAGTACCACCGCCGTGACATCCAGCACACGATCTCGCCGTCGATGGACATTTGTGTCTCGAGCAACTTCGA
GCGCTACCTCTTCGCACTGTCCGGCGAGAACCACGATGTTCTTCGTGGGTGGATGCAGGGCTTCGAGCAGACCGGAGAGCTCACGATTTCGGGCGAGCTG
CTCGCTAAGGCGCAAGACGAAATGGCCTCGTACGCTGTTCTCCAGACGGAGGTGCGCGCCACGATTGCTGAGTACAAGAAGGTTCACAAGTACCTCTTCG
ACCCGCACAGTGCTATCGGCGCGGCTGCTGCGATGCACTTCGGCCAGGACAAACTTGCTGACAAGCCCAACTCCGCAGTTGTCGTCGTTGGTACTGCCCA
CTACGGCAAGTTCCTTCCGGTTGTTTCCAAGGCGCTTGGTGTGGCTGAGACAGAGATCCAGCAGCACCCGATTCTGAAGTCGCTGGAGTCGCTCCCGACT
CGGCTAGCGGTCGCCAACAACTCGAAGGCTACTGTGGCCGAGCACATCCGCAAGACGATTGCCAAGCGGAATCAGAAGGCCAGTGGCAACTGCTTCAGTG
CCTGGGCATCAGCTCCTACTGAGTGCAAACTTGCCACCGTTGCGCTTGCGGTTGCAACTGTTGCGGCCGCCTTCTTTGTGGCTCGGCGCTCGAAGTAA