Transcript Name :
Phypl_g36
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_313225
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0290.03321
InsideOutsideTMhelix
1-205
*** None ***
PositionContextScore
119SVPRQRR|SS0.619
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        617 bases(100 bases per row)
ATGGCGTCCGCAGCGGAGATTCACGCAGAGAATGAACGTCTGGCGCGCGAGATCCAAGCGCTATTAAGCGCCAACACGACTCTGGAGAAGGAGGTGATGG
AGCTCTCATCCGAGCGCGACGACGGCAGCGAAAAGGTGCAGGGCTTAAAGCAGGAACTCGAGACTGTGGACAAGGAGCTCACGTCGCTGCGCTCGCAGTG
CCGGTCCATGACGGAGATCATCAAGAACGCAGAGACCGAGAACGACGTCGAGGTCGAGGAGGAGCCGGCGCCCCTGCCTGTCAGTCGCAAACTCTCCTCG
GCCTTTAACCACACGATGCAGCGAGCGCGGGGCATGTCTGTGCCTCGCCAGCGCCGATCTTCCACGGTGGAGATGGTGGCCCACGGCCTCACGAAGGCTG
CGAGCTATATGATCCCACCCACAACAAAAACCAGTCCCGACGGGCCTCAACGTGTTAGAATGAGCAAGGACAGCCCGCCGATCCTGTCATATGCAAAGGG
CACCACCGACTCGAAAAAGAGTCTTCTCTTCTCGACCCACTCGCATTACGGCAACTTCCGACGGCACAGCGGACCGTACCGCAAGAACCGGGAACAAGCC
CCTGTCATGGTGCTTTG