Transcript Name :
Phypl_g26
Orientation:
(+)
Number of Exons:
1
Description :
conserved hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.4050.226759
InsideOutsideTMhelix
1-147
148-170
171-190
191-213
214-397
398-420
421-440
441-463
464-737
738-760
761-827
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2483 bases(100 bases per row)
ATGACGTCCGCAGAGATTAACGCTGACGAAAACAACGCGGTGGTCGCTTACAAAACGGCACGCCAGAGCGCTCTCAAGCTGAGCGCCGTTGCGGGCAACA
CCGCCATGTCGGGCATGCGCCAGAAGAGCGACAGTTGGTACAAGGACTCGTTGTTCAGCTTCACCACCTACATCTGCGTCAAATCTTCCACGGAGGCAGA
ACTGGAGCGCTGCGTGGATTCCTCGAGCACTGACGCCGTTCGCGACATCAACGGCAAGTGCGTCGGGATGCTCGATGCAAACTCATGCAGCAGCAAGGGG
AAGTGCGAGCGCAGAAGCAACTGCAAGTGGGACGACGTTGTCCCCAGCGGAAAGGATGCCCGCCGTCAGCTTTTCACCGATGAGGATGTTACAACTGCGA
CTAAGTGGATGTCAACGGGATATCCCAGTTCACTGGCCCCTTTTGTAGCCCCTGGAACCGTCATGGGTGTGCTCACGGCACTTGGCTGCATCGGCTTCGT
AATGCTTCGGTGCGTGTTCAACCGTTGTGGAGGCCGCGAGCCAAACGAGAAGGGCTATTCACGTTGCGACATCATCATCCCAACCCTTACTTTCCTCGTA
TGCTCGCTGGCAGTGTTCATTTGCATGTGCATCACTGCTGCACTGAACACGAACATCTCGGATGGCGTCGAGGATGTACTGTATTCGCTGAAGGCAACTT
TAGAGAACGCGAACATCTTCGTGGCGAACCTGTTGACCCCACTGAACAGCGCCACTACGGAGCTAACTGCTGCGTCGAAGCTGGTAAGCACTCAGCTCAA
GAACTCGGACTGGATTGCTGCGGATGGCGCTACACTCAGGAAGATGATCGCGGACTTCGGCAGCATTTACTATCACCACGGATCCTTCCCGACGCTGACC
TGCGACCCCGCTACAAGCGATGCGTTCTGTATGACATGCCCCGACCGGGTTTGTGGCTCACCGGTTACGTTCTTCGTCAACAACACTGCTGCTGCCATTT
CCTCTAGCAGCGACGTGGTTGGAGACTCGGTCACTTTGCTGAAAAGTGCTTTCGTGACGAGCGGAACCGCTCTTGATTCGACTTTGCGCACGGCGGTGCG
GGATATGACGGCGTTGGGGGCATCCATGAACAGCTCCATGGATATTGTCGACGTACTCACCAGCACGTTCAACGACCTGTCCTTCTCCCGCAGTGCTCTT
GTGGTCTGCGTCTTCTTTTTCGGAATGATCGCGTCGATTGTGGGCATCATTGCCATCGTCAAGAATGCGTGCACTAGCAAGACGACGCAGTGGGTGCACT
TGCTGCACGTGAGCTGGTCTCTGGGTGTGCTCGTGTGCGTGCTGAGCTTTGTCCTGTCGGCTTCTCTGCTTGCTGTTGGTGCTGTGTGGTACGATTCTTG
CGAATATATGAAGCTGCTGCACCAGGATATGTCGCCGTACGCATCGACGCAGATGGCTTCAATGGCGAATGCTTGCTTCAACGGCAGTAGCATTCTGTCA
CCGCTGGGTCTTGACGTTCCGCTGTCTTTCTCCTGCAATGTGGAGGATGAGTACGTTGTCTTGAAGGCTGCAGACACTACGCAGATGGCGACGATCATCT
CGAGCTACGGCGAGATCGTTTCGAACTACGATCTCACCGACTTCAACTTTAACTCGACGAAAGCGAGGAGCCTTGTGGCCAAGCTCGCCACGGCAGCCGA
AGCTGCAGGCAAGAAACCAGCTACGAAGTTCACACAGGAGAATGTCTTGACTCCTTGGTTGGCATACAAAGAGTCGGCCACTGCCTACGGGTGCGTCAAC
AGCACCAGTGACGAGCAGCCTGTGTGCTACATGAGGGGCCTGTGCGACTCGAGCACGTACAAGGCTGCCTGCCAGCTCGCATTCTACGAAGCGTACGAGT
ACGCGTTGGCCTTCGACAAAGCCAGCACAATGCTGGACGAGATGCGTGAGACGCTGCTGGGAGACACGGGCAAGAACTTCCCGGACCTCTGGAATTACTC
CATGTCCATCCACGAGTTCGCCAGCAATTATTTCACTAAGATCACGACGCTGAAGACAGGCCCTCTGTCGACTATGCTGGGTGCTAATGGCGCCGTGCGC
AACCTGATGACGTCGGTGGAGCAGGCGCGTTGCTCGGGCGACTGCGCGTGGGCCAACCTGTCGTTCGACGCTATCAACGAGGCGCTCTGTAACAACGTGC
TAGGCACGACTCTGGGTATCTCTCTGTGCGCGCTGTTCCTGAGTCTGTTCCTGCTGCCTCTCATCATCTCGGCCATTATCCTGCAGAAGCGTCTGCGCGG
CGTGGCCAAGGGCACGTACGACCAGCTGGAGGCGCGTCTACAGGAGCTGGAGCGTCGCGCCAAGCAGCAGAAGGCGGAGAGTGAAGGCCTCGCACCAAAC
GGAGAGAGCGGCAGGCCGGCGGGCGGCTTGAGCGCGCTTGGTGGACTCTTTAAGGGCAAAAAGGTGCAGTCTCCTACTGTCTA