Transcript Name :
Phypl_g4
Orientation:
(-)
Number of Exons:
4
Description :
hypothetical protein PHYSODRAFT_492063
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.1130.12913
InsideOutsideTMhelix
1-198
NN-scoreoddsWeighted Score
0.6161.8170.004
*** None ***
TypeScore
cytoplasmic52.2
GO
*** None ***
*** None ***
*** None ***
Sequence
        960 bases(100 bases per row)
TGGCTACATCTCGACTGGTGCAGCGCACGGCAGCGTTTGTGGAGCAGCAGCTCAAGAGCAACGACGCGTCCCATGATTGGCGCCACATCGAGCGTGTCTG
GATGGTGGCGAGGACGCTGGCGAAAGAGGAGGCGCGTGCTATGGCTGGTGCTATTGGATGGGGTCTCCACTGTTGCTAATTGAGCGTTCTACTGTTATGC
GCAGCGCGTGCCTGAGGAAAACCTGGAGATCGTGGACCTGGCGGCGTTGCTGCACGACATCGACGATTGGAAGTACCAGAGCGACAAGGAGAAGCCTACG
AAGCGGGCGGCAGCCTTCTTGCAGGCGGAGAGTGTGTCCGGCGACAAGATCGATCGTGTGATGGCCATTATCGACAGTATGGGCTTCAAAGAGGAGCTGG
AAGGCAAGGGATCGGTACGTTACACTGTTTATTCAGATCCGTTCTGGTGGTCCATATTAAATGGCATATTTGGTTGTTAGCAAGCGTTTTCTGTTGAGTA
CGGCTGTGTCCAGGATGCTGACCGACTGGTACGTCGCGGATTAATAGCGATGGATTAAGGCTGAAGGACTTAAGGCAATATTTTGTGTAGGATGCTATTG
GGGCCATCGGAATCGCACGTTGCTTTACATACGGAGGACACAAACTCCGACCGCTTTACGACCCGGACGTGCCCCCGATTGATGGCATGACCAAAGAGCA
GTACATGGATCCGAGCCGTCCCAATACGACGATCAACCACTTCTACGAGGTAAGAACTCGCGTGTTGACAGTTGTTACTACTGGTTTGAGCTCTAACTAT
TCCGACGTTCTTGTGTTGTCTATTGATACGTGTTCAGAAATTGCTGAAGCTCCGTGGTATGATGAAGACCAACGCTGGAAAGCGTCTGGCCGAAGAACGT
CACGCGTTCATGGAGACGTTCCTGGATCAGTTCCATAAGGAGATCAGTGGTCGAGGATAG