Transcript Name :
Phypl_g39
Orientation:
(-)
Number of Exons:
6
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Kinesin, motor domain0.000000000000022PR00380
Kinesin, motor domain0.000000000000022PR00380
Kinesin, motor domain0.000000000000022PR00380
Kinesin, motor domain0.000000000000022PR00380
Profile scan predictionP-Valprediction_id
Kinesin, motor domain9.826PS50067
Kinesin, motor domain9.826PS50067
HmmSmart predictionP-Valprediction_id
Kinesin, motor domain0.0000000019SM00129
Kinesin, motor domain0.0000000019SM00129
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0520.04125
InsideOutsideTMhelix
1-174
*** None ***
PositionContextScore
114GSERLKK|SE0.607
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
microtubule bindingGO:0008017IEA
microtubule motor activityGO:0003777IEA
microtubule-based movementGO:0007018IEA
*** None ***
*** None ***
Sequence
        1907 bases(100 bases per row)
TGGACCATAAGGTCACTACCGACTACACCAGGTCGCTCGGGAATGCGAACGTCAAGGTATGTTGCATGTAGCACGAAGAGAACGCTTAGATTGACTCCTC
TATTGCTTAGGTATATGTTCGCGCGAGGCCATGCGCTGACGGCCAGAGCGCCCCCGAGGACATGTTCGAGCGCAAAAAGGAGACCCCGAGCAATATCGTG
ATCAAAGTACGGGAAGTGATGCCTTCTTGCTGCTGGTGCTTTACTAATGTGAACACATCACTAGGACACCGAACGAATGCAGTACGGAAACCACGCCTTC
AGCTTCGACAATGTACTGTATACCTGAGAGTTTGTATGGATTTCACTATTCTAATGGGAAAATGTGTTTACGATAGATCTATTGGACAGACACGACTCAA
GAAACACTGTTCGAAGCGGTACCAAACTTGACCACCCACAGCTCACTAGTGATTCATTAGGCTCACAAGGTGCGCTATCGTATTCTGCTTCAGACGAGCA
AGAGCCTGGTGGATTACGCATTGAAGGGTATCAATAGTTGCTGCTTTGCGTACGGACAGACTGGCTCGGGGAAGACATTTAGGTAAATCATTGGTAAACG
GTGGAAGCAAACAAATGACGTAGCTCTGCTCGTGTAATGCAGCATATTTGGCGAACCAGGAGGAGTGAAAGCAGGATTACTGTCGCGGTCGATTGAATAT
CTCTTCGAAATGGTAAATCGTCAGCAGAGCAAATCCAAGGTGCGTGAAGAAAATTTATTTTTCCAGCGGAATATCGCTAAGTGTTGATACGTTTTCTTAG
GAGGTGACCCTCGTTGTCAGTTTTCTGGAAATCTACTGCGATCATGTGCGTGATCTCGCTCGAGCGTACGTAGGTTTAGCTCAACAGCCTGCCCAACTGC
TTTACTAACGTCTACACATGAACTTCATGTAGGTACCTCAAGAAAACCAGTCGACCGGTGTCGTATCAAACATCAAGCAGCACCGATTGGTTTCTTCGCC
AAGTAAGTTTGGCTCCATTGGGATGTACTTCAAGTATTGGTATATCGGTGACAATGTACTCTGGCGCGAAAATGCATTGAACAGCAACAGCAGCAGATCC
CTCGAACCGAGAGTGCCGCTAGGTGCTGTACACTCTTGTAGATAAAATCGCAACTACTTTTTACCTCACCTACAGCTCTTGTGTCTAGCTTCAGCTCGAA
TCCATCAAAAGCCGAAGAAGACTACGACTACGAAAAAGGTGCGATTTATTCCGAAACTCATCCGGTGCAGATCTACTGACATGTGAGCACCTACACTTGC
TATGCGTTGATAGCAAATTATGAGATTCATGAAGATGCTCAAGGGAGAGTTTTCGTCAAAGACCTCTCTATGGTGACCGTAACATCGAGGGAAGAAGTGG
ATGCGATCATACAGTGCGGACTGAAACTGCGGTCTACGCACGAAACGAAAATGAACGCGGTGTCGTCACGTTCGCATACAGTTTTCACTATTCACGTCTT
CCAGCAAGGTACTGCAGCCAATGGACCTACTCCTCGACTAATTAGATAGTTCTTTTTAACGGTGTTGTTGTTTTGTAATGACAAAGTTCGAGACACAGAA
GAAGTAATCTATGGGATGCTGAACATGGTTGACCTCGCAGGGTGCGTAAACAGTTGGAATTTGTGTTTACCTTCCGGTATTCTGACACTAACGTTTTGCT
GGTAGATCTGAGCGTCTGAAGAAGAGCGAGTCGGACGGCCAGCGGTTGAAGGAAGCGTTGCACATTAACTCGAGTTTGAGCGCAGTGGGCAAAGTTGTGA
TGTCCCTGGATCCGGAGAGCGGGTACAACTACATTCCTTACCGCGACTCAAAGCTTACCAGACTCCTCCAGAACAGTATTGGTTCGTTTCAGCGTCTCAA
CTTGTAG