Transcript Name :
Phypl_g13
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein PHYSODRAFT_465114
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Small GTPase superfamily1.3e-35PR00449
Small GTPase superfamily1.3e-35PR00449
Small GTPase superfamily1.3e-35PR00449
Small GTPase superfamily1.3e-35PR00449
Small GTPase superfamily1.3e-35PR00449
Small GTPase superfamily1.3e-35PR00449
Small GTPase superfamily1.3e-35PR00449
Small GTPase superfamily1.3e-35PR00449
Small GTPase superfamily1.3e-35PR00449
Small GTPase superfamily1.3e-35PR00449
Profile scan predictionP-Valprediction_id
Small GTPase superfamily, Rab type30.604PS51419
Small GTPase superfamily, Rab type30.604PS51419
HmmSmart predictionP-Valprediction_id
Small GTPase superfamily, Ras type1.2e-24SM00173
Small GTPase superfamily, Ras type1.2e-24SM00173
Small GTPase superfamily, Rab type0SM00175
Small GTPase superfamily, Rab type0SM00175
Small GTPase superfamily, Rho type0.00000000085SM00174
Small GTPase superfamily, Rho type0.00000000085SM00174
Ran GTPase0.0048SM00176
Ran GTPase0.0048SM00176
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0250.0585
InsideOutsideTMhelix
1-290
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
GTP bindingGO:0005525IEA
GTPase activityGO:0003924IEA
intracellularGO:0005622IEA
membraneGO:0016020IEA
intracellular protein transportGO:0006886IEA
protein transportGO:0015031IEA
signal transductionGO:0007165IEA
small GTPase mediated signal transductionGO:0007264IEA
*** None ***
*** None ***
Sequence
        1230 bases(100 bases per row)
ATGACTACGGGCGGCAAGCACGAGCTGCCGGCGTCCTCCACGACCACGACGTCGTCTTCGTCCGACAACAACAGTAATGCGGCGTCTGGGAACCCGCTGC
AGCAGTATATCTCGGCCAAGGAGGTGGCGCAGCACCAGGTCTTCCGCCAGCACGACATGCGGCGCTCCATCAGCTCCACGCAGTTCAGTGGCGGTCGAGA
GAGCGCGTCCAGCCCGGCGGTTCAAGGCTCCAGCAAGACTTCGGTCGTCGGGTCTTCCATGTCGGCGTCCAACAGTCCGCGCTTTTCATCTCCAGCCTCG
TCGCCCATGGCCGAATCCATCTTAAAAGTCGTACTGATTGGCGACTCAGGTGTAGGCAAGTCGAACCTCGTCATGCGCTTCACCAAGAACAAGTACATGC
CGCACAGTGTACAGACGGTGGGCTTCGAGTTCGCCACCAAGACGATCAGGGTCGGGGATCGGCGGCTCAAGGCGCAGATCTGGGACACTGCGGGGCAGGA
GCGTTTTCAGTCGCTCACTGCAGCCTACTACCGCAACGCTGTAGGTGCCATGATCGTGTACGACATCACGAACCGAAGCTCGTTTGAGCATGTTACAGGG
TGGCTCGCACAAGTGCACGAGCACTCACACCAGAGTCTCGTGCTGATCCTCATCGGCAACAAATGCGACCTCGCGCACTTACCGGAGAGTAGAGAGGTGT
CGACACTAGAAGCGGCGCGATTCGCAGCGAAGCACTCGATGGAGTTCCTCGAAACATCCGCTTTAGACTCGACCAACGTCGTGGACGCCTTCAAGAAGCT
CATCGTGCCAGTGGGGCGTCTACTGTCGCCGACAGAGCCCAAGAAGATTGCGAAATTACCCCCAGGGTGGAGACGCGTTCTATCAAGAACCAGACCCGGC
GAATACTCGTACGAAAACCAATACACCAAGGAGCGGATCTCATTTGCGCCAAAAGAACCGGCCAAGCCCTCTCAGCAGAGCTTTCGGGCTCCTTATAATG
GCTCGAAGAGCAACCCGCAGGGCGTCGTTACCGTCACGCGCGAGAGCCTCCAGAGGCAGCATCAGAAGGCGTATCTCGCTCAGAATCAAACACCCCAGTG
TGGGGTCTGTGTAAGCAACTGCACAATAATGTAGGCATCGGGGAGATGTCGAACGGCTTGCTTCGTGGTCATCAGGCTACGGGTTAGTCGTCGACTTGTT
CACTGCCAACACTGTCGAGGACACTGCGTG