Transcript Name :
Phypl_g25
Orientation:
(-)
Number of Exons:
6
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain32.018PS50011
Protein kinase domain32.018PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain4.1e-24SM00220
Serine/threonine- / dual specificity protein kinase, catalytic domain4.1e-24SM00220
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0390.022330
InsideOutsideTMhelix
1-375
NN-scoreoddsWeighted Score
0.7631.5110.003
*** None ***
TypeScore
mitochondrial47.8
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        3149 bases(100 bases per row)
TGCTGGAGTCGCACAAGAAGAAAAAGAACCGCCACGTGTCCAAGCCTGCCGCCACACGTAAGACATCGCAGCCCGCTCCCGCTGCGCCCATCTCCAACAG
CGCTACCACGAGCACGTCGCACCGCCGCGACCTGCTGGACGGATCCATCCAGGAAGTCTCACGCAAGACGCTCATGGAGAGATTCCGCAAGCGCGGACGC
GTGGAGAGCGCCAGCTACGAGAATGGGCGTGACCGGGCGACAGCCAACACGACGCTGCAGTCCAACAGCTCGTCTTTCTCGACCTCGGGCCCCATCGTGC
TGCGCGGGGGGCGAGCGCCGCACCATGCGACATTCCTGGTGCATAAGAACACGCTGGCGAGGCCGCAGTCGGCGCCCAACCTCATGGAGCAGGTTTGATA
GCTCGGATATAATAATAGGTAGTACTGGGACTGACGCTCTTGTACTGTAGGCGGACGACGAAGTGATCGCTCGGATCTTCCCCGATATCTGTCCACGTGA
GCTCCGGATTGCAGAAGTTAAGTCATGGGAGTCTCCGTGGATGGAAAAGGAGTTCCCAGTCTCTCCAGAGCCAGAAGCAAAGGTGTTGAAACAACCACAG
CAAGGAGAACTGTTATCAAATGCTGCAGATGCAGGGAAGAGAGCTTCGTCTGTGACTTCAACGTCAGATCAAAAACGATCGGACATCCCAGCTTCTCCGA
TAGCAGCTAACAACAATGGGCTTCATCGGAATAAAGCAGATAAAACGGCGAAGAAACTGGATAAGGAAATCAACTCGCTGACGAACCAGTTGTCACTAGA
AGAAAAACGGCCGAGGCCACAGTCCCCGCCGAAGAAGACGGCGTGGTCGCAAACAGCAGGAACGCCGCCTCCAGTTTCTACCCCACGCACTCCGCAATGG
AAAGCAGTTGAATCGGCGAAAAGAACCCAAGGGAATCGCATTGGCAAGAGACCGCAACTACGCCTTAAGCTGGAAGACATGCCTACACCCCAGCAAGCTG
AAGAGCGGGCACAGCGAGCTGCCACTCGACTCATTGCCAAGCGAGACGCTATGGAGGCCGCTGCGATTGCGGCCGCTGCTGCATCGGGATCAAATACGCC
TTCAAAAGGTCCAAGTGCCGCGCAGCAAGTGATGATGAAGTTGAATTTTAGTTCAGGCTCCGACTCAGATCTTCACTCTCCAAGTGGTGCGGTTTGTTGG
TGTTTTATGAATGGCTGAAAGCTGCTAACTTGCTGTTTATTTGGGTGTTGAACCCGTGCAGAAGGCGAACGGCATAGCGCAGGAAGCGCTTATTCGCCTA
ATCACGGCATGTTCACGACCAGAAATGTTGCCGTGTCAGAAGCGGGCATTTCATCACCGGATGCTGCATGTTTACACCTGCAAGAGAATCTTGAGCGCGT
GAAAGAAATCGGCCGAGGTGCTTCTGGTGTGGTGTACAAGGCAATCCACATTCCGACGCTGAAAGTGGTCGCTGTTAAGGTCGGTATTTATCTTCGAGGT
TGAAAGATGTGCGTCGTTACTAACTTATTCTTTGTTAATGATGAAGGATGTACCAGTTTACGGGCGTGGCCAGCGCCGACAAATGGTTCGCGAGCTGCAC
GCGCTGTATTCAAACCTTGCACCCATGGCAGACAATAGCCCAACACCTACTGGAAAGAGTACTAGCAAACCCAAAGCCAAGTACGTGCCCGCGATCTTTT
TTTCTATGATGTTGGTATTGCTTATTTAACGGGGCCAAATTCTGTTCATAATGTCTAGGCCTAGTCCCTACATCGTCTCCTTCTACGATGCATTTGTTGA
TCGCCCCAAGAACTCCATTTGTATGGTCATGGAGTACATGAGTACAGGGTCATTACAGGATATCGTTTTGCGCGGTGGCTGCCAAAATGAAAAGGTCCTA
GCACGGTTATCAACTGGTGTGCTGCGTGGTCTAGCCCACATCCACGACAAGCGGATGGTGCACCGTGATATTAAACCACACAATTTGCTCACCAATCGAC
AAGGTGAAGTCAAGATTTCGGATTTCGGTTTGGCGCGCACGTTAAATGATAACTCCACCTCTACGAAGACGTTTGTGGGCACCTTACTGTACATGGCCCC
TGAACGGATAGGCGGTGGCGATTATTCATACCCAGGTAAGACGGTACCATCGCTTTGTGCGTTCACTTTCATAGACTGATCTGACTGTTTTCAATGTGGT
ATTAGCTGATATTTGGTCATTCGGACTTGCGCTGATTTCTGTTGCTTTGGGCCGCTACCCGCTTCCGACGCAGGACGGGTTCTTTGGCTTGGTTGACTCT
GTATGTGTTTTATTTACAAAGGCTTGACGTTATAGGGTGCCTGACGTAGTGAACATTTTCCTTACAGGTTGCAAATGAGCAATGCCTCAAATTGCCAGCC
GAGTCATATTCAGAAGATTGCCGCTCTTTTGTTGAGCAGGTTTGATGAAAAAGCCGTTGATTCGAAGGATTCTGCGCATGCTGACTGTCGTTTTGCAGTG
TCTAATGATTGACCCAGATGAACGGCCATCCGCAGAAACACTTCTCCAGCATCCTTTTATCAACAAATTCACACCTGAAGAGACCTTAGTTGAGGTAAGT
TGTCCGTTAGTGAACCTGGCATGGAGGTGTCGTGATGTTTGACAGTGCGTTTTCTATTGTGATGGTAGTGGTCATTGTTCGTCGATCGGGTGCACCTTTG
TGAAGAGCGAGGTAGCGAACTGGAATCGCTCAGTGATGCAGTCTATCGCCACATGTATGAGCACTCAGTCAAGTTTTCCCACCTACCGCAGGCAAGTCTT
GTTCGTACATTGGACTCCTTGCTTGTAGATTTGTCTAAAGGGCTATTGTTTCTATGAATTCAGTCCGACTACGGCGTATCGTTTGTATCGCAAGCCACCC
CGACATTTTCTCGACGGCAAATATCCCTACAACCAGTACAAATGAGGTGAGAGCAGCTCTAAAGTAGTTGTCATGTGGAGTTTATTCGTGACGACCTCCT
TTTCTGATTTTTTGTTTCTTGTTATCTGCATTAGCTTACAGCTCGGTCTGGCCAATTACTTGGATGTGCCTGTGCATATTGTCTACGAGAAATTCGAAGA
GGTGGGTCCCAGTTGTGGCATCAATGTTTGCTTTCGACGCCTCAACTAA