Transcript Name :
Phypl_g11
Orientation:
(+)
Number of Exons:
4
Description :
DEAD/DEAH box RNA helicase, putative
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RNA helicase, DEAD-box type, Q motif9.681PS51195
RNA helicase, DEAD-box type, Q motif9.681PS51195
Helicase, superfamily 1/2, ATP-binding domain17.878PS51192
Helicase, superfamily 1/2, ATP-binding domain17.878PS51192
HmmSmart predictionP-Valprediction_id
Helicase, superfamily 1/2, ATP-binding domain4.1e-25SM00487
Helicase, superfamily 1/2, ATP-binding domain4.1e-25SM00487
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Helicase, superfamily 1/2, ATP-binding domainIPR014001
RNA helicase, DEAD-box type, Q motifIPR014014
Y-scoreD-scoreY-pos
0.0660.07745
InsideOutsideTMhelix
1-223
NN-scoreoddsWeighted Score
0.5952.4130.005
*** None ***
TypeScore
cytoplasmic47.8
GO
*** None ***
*** None ***
*** None ***
Sequence
        971 bases(100 bases per row)
ATGGTGCCATCTTCCGACACGGCGCTAGCTGCCAGTACGACAACATTCAGCGACCTGCCATTGCACGGAGATGTGGAGCGTGCACTTACAGCTATGCGCT
TTCTCCGTCCGTCGCCTATCCAGCTGCACGCGCTACCCGTGACTCTGTTTGGTAACGATGCTATTGGTCAGGCCAAGTCCGGCACAGGCAAAACTGCAGT
CTTCGGAGTCACAGCCATCGAGCACGCGATCCGTAACATCGAGCAACGAGGCCTGGACACCGTAGTGGGAGACCCGTTAGCTCTGATTCTGGCGCCAACG
CGAGAGATCGCAGTCCAAATTGAGGCTGTGCTGCGTCAATTGGCACAGTTCCGGCCGGACATTGTCATCCGCACGTGCATCGGTGGTTTGTCCGTAGCTC
AAGACCAGGTATCTGGAGGTGCATGTGTCTGTGTTTTTATGTTATACAAATTGACTGGGTGGTGTTTTGAGCAGATGCACTTGGCAGCGGGGTGTCATAT
TGTGGTCGGCACGCCAGGACGCGTGAAAGCACTTGTGGGCCAATGCTCTTTGCCGTGTAGTTCTATTCGACTGCTGGTGCTGGATGAAGTGGATAAACTG
ATGGCGCGTGACTTCGAGAAAGATGTACGGTGTTGGTCTAAAGCCGTAGTGACTGGAACTGGTATTGACAGCCTTACTGTGTTATAGATCCAGTACATCG
CGGATGCACTCCCTGAACGACGACAGGTAATAGGCAACTCTAACGACAAAGCTGGGATACTGGCTAACGCGCAATTATTGTGCGTGTGTTTTTGTTTTTA
CCTTGGTCAGACTCTTGCATTCTCAGCGACATTCACACCTGATCAGCTTGTTGCTGTCGCGCAGCTAATGAGTACTCCACAGGTGTGTAGATTGAAGCAA
AACCTACGTGTGAGTATTTACTAAGTTTCGTGCTACTTTTAATTGAGCAGATCGTGCGAGTTCGAGGATTA