Transcript Name :
Phypl_g2
Orientation:
(-)
Number of Exons:
1
Description :
eukaryotic translation initiation factor 3 subunit, putative
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Tetratricopeptide repeat93SM00028
Tetratricopeptide repeat93SM00028
Tetratricopeptide repeat110SM00028
Tetratricopeptide repeat110SM00028
Tetratricopeptide repeat14SM00028
Tetratricopeptide repeat14SM00028
Tetratricopeptide repeat41SM00028
Tetratricopeptide repeat41SM00028
Tetratricopeptide repeat170SM00028
Tetratricopeptide repeat170SM00028
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.140.09134
InsideOutsideTMhelix
1-1297
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        3893 bases(100 bases per row)
TGACCACCGTCGCGTCGGAGCAGCAGCAAGAGCAGGTTGAAGCCGTGCAGGAGGGCACCTTCAGCCTGCTGGTGGCTCCCCCCACCTCCAAGAGCGCCCA
GCCCGTGCGACTGGAGAACGTCAGTGCGTCGGACACTGTCGTGGCGCTGCGCCAGCTCATCGCCGAGTTCCCAGCGCTCGCCTGCTACACGTGCTACCAC
CTGGAGGCCAAGAGCCTCGCGGATGACACCTGGCAGCCGCTTAACGACTTCGTGGAGCTCGCCGAGTACGAAAATGTGACGGAAGGCGCTTCTCTGCGCA
TGGTGCTGGACAAGTACGACGCCCGCAAGGTGCGCGCGCAAGTGCGTCGCTTCCGTGACGTGCTGAGCAACCCGCCCATCCCCCAGGCTGCAGTGGAGCC
TGAGGCACACCCGGAGACTGCTGACAAGGTTGAGGAACCTGCTGATGGCGAGGAGATGGACGAGAAGAAGCTGAAGGAGATTTCGGAGCAGCAGCTTAAG
CGTCTGCGTGAGATTCACCACAAGCTCGAGGGTATTGAAGTTCCTGTGGCTCCTGAGCTTGCTGAGTTCTACTCGTTCCCTGGCGCTGCTTCCACTACGC
AGGAGGAGAAGGAGCAGACGGAGACCCCTTCCAAGGGCAAGAAGAGCAAGAAGGGCAAAAAAACCCAGCAGAAGCAAAAGCAGCAGCAGAGCGAAGCCAA
CCAGCAGAAGGAGCAGGAAGCGCAGCCTGACGCCAAGCTCCCTGCCTGCGTTAAGAGCATTGTGTTTTCGGGCTACAACCCGCCTCCTGGACCGCGTAAG
CTGGCGGGAGACCTCTTCTACCTGGAAGTGATCGTCGCTGGGGATAACACGCGCTACCACATCACAGCGCACGTCAACGGATTCTTCGTGAACCGATCGA
CGGCCACCAAGTTCGACCCGCGCCCGCACAAGACCGCTGCGGCGCACTCGCACTTGCTTGTGGACGTGTTGTCCACCGTGTCGTCGAAGTTCAGGGAGTC
CTATGCTGGTCTCCTGTCCAAGGCAGCCTCTCTGGCTAAGGAGGGCCCTTCTTCGATCGAGTGGATGGTGGCTGCTGGCTCCAACCTTGGCGGAAAGCTG
CCGTGGAACACCCCTGTTGCTGCTGCGGAGGAAGAGCACCACTACGACCTCAACCGCGCGGAGGACGAGCTATGTGCCTCCTACGGCATGGACGAACGTG
GTGTGCTGCGCGACTGGAACGAAGAGTACCAGTGCTGTCGCGAACTGCCGAAGGACTCGCTTAAGGAGGAGATCGTGCGCGCTCGTGTTATGTACAAAAT
TGTGACGGAGTTTGTGGAGGCTGCCACACAAGGCGCAGTGGCCATTGTTGAGGGAAACATTCCTCCTATTAACCCCATGGATGACAAGAGTGCTCACGTC
TACGTTTTCAACAACATCTTCTTCTCAGTGTCCATTGATGGCAATTCCACCAAGGACGCTGCTGGAGGTGAGGAGAACGCCTTCTCGGCTGCCAACCGCG
ACCTGCAGGGCGTGAAGGCATTTAACGAGGTGGATGTAAAGGGTTTGCACACCCTGGCCACGACAGTCGTAGACTACCTTGGAGTCCGTGTCATTGCTCA
GAGCCTTATCCCGGGTATCCTTATGGGCGACGCTGCCTCCAAGCTCGTGTACGGCTCGGTAGACCACGGCAAGACTATCGCTGCCAACAGCGACATGCAC
AAGCTCATGCTCGAGGCAGGCGCAAAGCTCCACATCGCTGAGCGTAATATCAAGCCTCTTGGCAAAACTGAAGCTGACCTAGCTGCTGAGAAGGAGATGG
AGGCTCTTGGTGGCCCCGTGAGCAGTGGAGAGGCAAGCACGGAAGTGGCAACCATTTGCGGTGCCGTTGAGGCGAAGGGAATTCAGGGCTCGGACGGGCG
CCTGTATGTCTTGGACCTTGTCCGCATTACCCCGAAGGATTGGAACTTTTACAAGAACCGCGAAGGTGCTCTGAAGAACACCGAGGAGAAGAAGGATGCC
CCGTCTGAGGAGGACGGATTGTGCTTCACGCGTAATGACGAGGGCTATGTGGCTCTGTTACGTCCGGAGCTGGTGCAGCTTTACTCACTGTGGAAGCAGA
ACCAAGCTCGCCGCGCTAACCGCGAGGCCCGCAAGGCAGCCAAGGAAGCAAAGAAGGCCGCGGAAGACAAGGAGAAACAGGAGAACGGTGCCAAGGAGGA
CGCCGAGAAGAAGGGCGATGTTGCTAGCGAGCAGGAGACTGAAGAGCAGGAAGACGAAGAGGAGGAAGAAGAGGTTCCGCCGATCTCGTTGAACCCGAAC
GTCTTCATGGACTACGCGGCTTCCACCGATGCGGAGCAAGTTGCGGCTGATGAGACTGCCGCAAAGGATGCTGCCGAGTATCTGCAGCGGATCGTTGTAC
CCGCGTTTGTCGCCGACGTTCGTCGTGGTGCCATCGCCCCTGCTGATGGCTATGCTCTTACGCAGCTGATGCACTCCTGCGGCATCAACATGCGCTACCT
GGGTCGTCTCGCCTCGCTTGCCAAGAAGCTGGAGGCTATTGGCGGAGTCTCCAAGTACTTGCTGGAGATGCTCGAGGTGGAGATGATCTCGCGCGCTGCT
AAGCACATTCTTGCTGATATCTTGGATTCTAACGATTCTATCCGCGCAGCTCCTGGAACGGCGATTGTAAAACTCCTAAATGGTATCCTTGGTTCTAGCT
CGGCTTCTCTGGACAAGACGGAAGCTTCGGAAGACATCGCCAGCGATGCTACTGTTACAACGGCTTCGTTGGATGCGAAGACCCTATGGACTCGCATTGC
CAAGGAGATTAAGGCCCGATTCGACTACAATTTGACTTTGTGGAGCCCTGACCGTGAGGCACCCCGTAGTGAGGATGCTTCCTTCCCCATTGGTCGCGTG
AACAAGGTGGTCATGCTTCGACGTCTGTGCCAGCGCCTCGGTCTGCGCGTTGTGAGCCGCAACTATGAGTTCTCGTCGTCCTCGCCGATCAGCCTGGATG
ATATTACTGGTGTTGTGCCCGTGGTGAAGACCTCGCTGCCTACTCACCCGTTGGCCCAGGCCAAGCAGCTTCTTGAACGTGGCCGCGTGCACTTGAGCCA
GGGTGCTCTGTCGAGTGCGTACGAGTTCCTGCAGGAGGCGTCGTCGCTGCTCTTCCAGGTATGCGGTGCAGCTCACGAGGACGCAGCTTTGTGCAGCTCG
TCACTCGCTACTGTGCTATATCACGCTGGCGATGTCGCTGGGGCTATTGCACAGCAGCAGCGTGCGCTGGCCCTGTACACACAGCTCCAAGGCATCGACT
ACCACGACACGGCCTACGCTCACGCGAATTTGGCGCTGTTCCTGCACGCAAACGCCCAGACCGATCTGGCAGTACCGCACATCCGCCGCGCCATTTACCT
ACTGGAGTTCTGCTGCGGCCCTCACTTCCCCGAGATCAGTTCGCTCTACTTTAAGATGGGAATGATGTGCCAGGATGTGGGACAGATTTCGCTGGCTTTG
ATGTGCCACCGCGAGAGTCTCCGTCGCGGTGAATTTGACCGCAACCAGGCGGCAAACACTCTGCACCAAATGGCTCTGGCATGTAGTCTGGCTGGCGGCT
ACCGTGAGGCTCTTACGTATGAAAAGAAGGTGTACTCGCTCTTCCAGGAAGCTTTCGGTGACGAAGACCCGCGTGTGGTCGAATCGGCGAAGTTCATGGC
CAAGTTCACGGAGAAGGCTGTGGAGGGAGCTAAGGGCCGTCGGGAAGTGGACGCCGCTGAGGCGGCTGATGCGATTGCCAACGAGTTGCTTGGGGAGCTC
GAGTTCAAGACGAAGCCTGAACAAGATGCTGGATCTCCGCCTGCTGCGGCCAAGAAGAAAAATCGCAAGTCCAAAGGCAATAAGAAGCACTAG