Transcript Name :
Phypl_g37
Orientation:
(-)
Number of Exons:
1
Description :
myosin-like protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site7.346PS50096
IQ motif, EF-hand binding site7.346PS50096
IQ motif, EF-hand binding site7.089PS50096
IQ motif, EF-hand binding site7.089PS50096
WW domain11.999PS50020
WW domain11.999PS50020
HmmSmart predictionP-Valprediction_id
Myosin head, motor domain0SM00242
Myosin head, motor domain0SM00242
IQ motif, EF-hand binding site10SM00015
IQ motif, EF-hand binding site10SM00015
IQ motif, EF-hand binding site200SM00015
IQ motif, EF-hand binding site200SM00015
IQ motif, EF-hand binding site12SM00015
IQ motif, EF-hand binding site12SM00015
IQ motif, EF-hand binding site7.5SM00015
IQ motif, EF-hand binding site7.5SM00015
WW domain0.00000004SM00456
WW domain0.00000004SM00456
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0580.06825
InsideOutsideTMhelix
1-1255
*** None ***
PositionContextScore
396LCSRTMR|AV0.604
628PGGRRKR|GG0.549
1154YDNRSKR|TN0.716
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein bindingGO:0005515IEA
motor activityGO:0003774IEA
myosin complexGO:0016459IEA
*** None ***
*** None ***
Sequence
        3767 bases(100 bases per row)
TGAGCGACCTGCAGATGGTGGTGGGGGCCAAGTGCTTCGTGCCGGACGAGACCCACGTGTGGCTTGCGGCCGAAGTCCTGCGCGACGAAAACTCGGGCGA
CGGCAAGACCCGCAAGATTTACTGCCAGGTGGAGCTGCCCGACGGCGAGACTGAAGAGCGCTGCGTGGATATGCTGTCCAAGAAGACTAAGGCGCTGCTG
GACGTGCACCAGCTGGAGTCGTTGCCCTATCAGAACGAGAACGTGGGCCCTGAAGGTATTGAGGACATGATCACGCTCAACTACCTGCACGAAGCTGCCA
TTCTCTTCAATATCAAGAAGCGTTTCATGTGTGAGCTACCATACACGTACACGGGCGACATTTGCATCGCCCTCAACCCTTACAAGTGGCTCCCGGACCT
CTACGCTGAGGAGCAGCACCTCCGCTACCTCAACCAGCCCAAGGAGGAGCTTCCCCCGCACGTCTACGCCACGTCAGTGGCTGCTTACGACAATATGCGG
CGCTCGGAACGCAACCAGTCCATCCTGGTGAGTGGAGAGTCCGGTGCTGGTAAGACGGAGACCACGAAAATCCTCATGAACCACTTGGCTACCATCGCCG
GCGGTCTGAACAACTCTACTATTAAGAGGATTATCGAGGTGAACCCACTGCTCGAGTCCTTTGGTAATGCCAAGACCGTCCGTAACGACAACTCCAGTCG
ATTCGGAAAGTTCACACAGCTGCAATTCGATGCGAACGGCACGCTTGTCGGCGCCAAGTGCCGCACATACCTGCTCGAGAAGACCCGTGTGATCCAGCAT
GAAGCACCTGAACGCAACTACCACATCTTCTACCAGCTGCTGGACTCCTCTGAGATTGCACCGGAGCTGCAGCTTGACCCCAGTAAGCACTACGTGTACA
CGGGCGACAACACGGCGCAGAAGATCGAAGGCCTCTCGGACGAGAAGCACTTCAACAAGACACGCGAGGCGCTTGAGCTAGTGGGTCTGTCCCGCGACGA
CCAGAAGCCGCTCTTTGAGGTGCTAGCTGGTGTACTTCACCTTGGTGAGGTGCAGCTGCAGTCTGATCCGGCTGATGACGAGAAATCTCTCATCACTGAA
GGTGACAGTGGTGCGAACTCCGCGACTCAGATGCTCGGAGTCACCTGGGAGGCGCTTCAGAACGCTCTGTGTTCGCGTACAATGCGTGCTGTAAACGACG
TGTACAGCGTGCCACTGAAGAAGGAGCTGGCTATGGACTGCCGTGATGCACTCTCCAAGGCCATCTACTCGAACGTCTTCGACTGGCTTGTGGAAACAAT
TAACCAGTCGCTTGCTGACGATGCCCATATGGTCAATCATGTCGGTGTCCTTGATATCTTCGGCTTCGAGCACTTCAAGCACAACTCGTTCGAGCAGTTC
TGTATTAACTACGCCAACGAGAAACTGCAGCAAAAGTTCACGCAGGATGTGTTCAAGACCGTGCAGATCGAGTACGAAGAGGAAGGCATCGTGTGGGACC
ACATTGAGTACGCTGATAACCAGGATGTGCTGTCCGTGATTGAGTCGCGCATGGGTATCATTTCGCTATTGAACGAAGAGGTGATGCGACCGAAGGGTAA
CGAGGAGTCCTTCATGTCCAAGGTGACGTCCCTGCACAAGGATGACATGGCACACGTCATTGAGTTCCCTCGTACGTCCCGCACAGAATTCCTCATCAAG
CACTATGCTGCTCCTGTGATGTACGATTCGGTGGGCTTCCTGGAGAAGCACAAGGACTCGTTGCTGCCTGATCTGTCCGAGCTCATGCGTGGTTCGTCCA
AGCCGTTCATCGCCAAGCTCTTCGAACCCAAGCCGGAGCCCAAGGCTGCTGTCGCAGAGGCTCCTGGTGGCCGCCGAAAGCGTGGTGGTGCTCTGTCCAT
CACGACTGTCGGTACCCAGTTCAAGGAGAGTCTGACAGAGCTGATGGCTACTATTAACTCGACCCGTGTGCACTATGTGCGTTGCATCAAGCCCAACCCG
ATCAAGAGCTCGACGGCCATGGATCAAAACATGGTGGTCTCCCAATTGCGATGCGCTGGTGTGATCGAAGCCATTCGTATCTCGCGTGCAGCATACCCGA
ACCGATTGCAACACACTGAAATCCTGGACAAGTTCTGGCTGTTTGTTCCGAGTGGCGGCGAGACTGCAGCAGACAAGTGCCAACTGCTTATGGATAAGCT
GAAGCTGGAGTCACCGACGCAGTACCAGATGGGTAAGACTCGCGTGTACTTCCAGCTTGGTGTGCTTGAAGAGCTTGAGGACCGTCGTAAGAAGTTCCTG
GATGCCAAGGCCACCTACCTGCAAAACATCATGGTTGGCTTCACGCAGCGTATCAAGTACCTCCGACAACTGGAAGCGATCATCAAGTTGCAGTCAGTTA
TTCGGTGTGTGATTGCTATGCGCAGATACAACATGTTCTTGAAGGGCCTCATTTCGGCACAGGCACACTGGCGAGGCATGCAGGGCCGCAAGGTGGCTGC
CGATGTCAAGAGCAACCACTACGCTGTCATCATCCAGCGGTATGTTCGTGGACTTGTCAAGCGTCACCGTTACGTTAAGATGCGCGCAATGGTCATCCGT
GTGCAGGCTGTGGTTCGTATGACGATCCAGCGACCAAAGTACCTGGCTGCCCTTGAGGAGAAGCGTCGTGAGGCGGACATGGCTTACCAGCTGCAGAAGC
TTAAAGCTGCTCTGCAGGACGAGCAGGAGCGGAATGCTCAACTGCAGCGCCGCAGCAGCGTGGCGACGGCTGACTCGTCCGCTGCCTCGAGCGTGGTCAT
GGCTGACGCTGGTGGTATGATTGAGACTCTCACGGACGAGAACAAGAAGCTGCGTGAGAAAAACGAGGACATGAAGGTGACGATGAAGGGTTTGAAGGCG
GAGATCGAGAAGTTTAAGAGTGACAAGGAGTTCTCGTCTGCTGGTAACCACGTTAAAGTCCGGCAGCTGCAGGATACTGTGCGTGACAAGGACAAGAAGA
TCTCTCATCTTGAGGCCGAAAACAAGAAGCTCACGGAGCAGATCGCGAAGCTTCATGAGGACGGTGTTGTTCCCGAGAAGAAGCCCACGCCGAAGAAGTC
GATCTTCCGCACGCTGGGTTCCAAGAAGGAGAAGAAGCCTCGAGAGACTGTGCTGATGGACTCACTCACTGGCTCGGACGACCTTAACCGTCGCTCTTCG
GAAACGCGTCCTTCGGAGCGCCACTTCCCGCGCATGCCTAGCATGAGCGTGGGCTCTCGCTTCTGGAACTCTAACAAAAAGGGTGACAACGGCGACGGCT
TTGACGTCTCGGAGGTTGACGGCGAGGACAGCCCCACGAACAGCTCCACCACGCGCAACACGATCGTGAAGAGCATGGAAGTGGGCGTGACCGGTGCCAT
GTCGAGTCTGAAGGGCCGCATGTCGGTCGTGAAGGGCATGTACGACAACCGGAGCAAGCGCACGAACAGCAAGCCTGAGGAGACCGCGAACCCGTCCGAC
AACGTTGCGTCGACGACGGTTGTCACCTCGAAGAGCGCCAAGGTGAAGCCGGCGAAGCCTGATGACCGCCCCGTGCGCGAGTCGTTCAACCTAGATGCGT
TGCCGGAGGTGTCTCTGCCTGTCGGTTGGGAAGCGAAGGTGTCGCGCTCGACGGGTCGCGTGTACTACGTCAACCGCAAGCTCGGCAAGTCCCAGTTCGA
GCGCCCCACTTTGGCGTCGCTGAAGGCGCAGAAGCTGGCGCGCCAGAAGTCGGCTGGCGCGCTGTAA