Transcript Name :
Phypl_g42
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site7.291PS50096
IQ motif, EF-hand binding site7.291PS50096
IQ motif, EF-hand binding site8.096PS50096
IQ motif, EF-hand binding site8.096PS50096
IQ motif, EF-hand binding site6.87PS50096
IQ motif, EF-hand binding site6.87PS50096
IQ motif, EF-hand binding site8.279PS50096
IQ motif, EF-hand binding site8.279PS50096
IQ motif, EF-hand binding site7.254PS50096
IQ motif, EF-hand binding site7.254PS50096
IQ motif, EF-hand binding site7.986PS50096
IQ motif, EF-hand binding site7.986PS50096
HmmSmart predictionP-Valprediction_id
Leucine-rich repeat, cysteine-containing subtype0.00078SM00367
Leucine-rich repeat, cysteine-containing subtype0.00078SM00367
IQ motif, EF-hand binding site0.025SM00015
IQ motif, EF-hand binding site0.025SM00015
IQ motif, EF-hand binding site5.1SM00015
IQ motif, EF-hand binding site5.1SM00015
IQ motif, EF-hand binding site23SM00015
IQ motif, EF-hand binding site23SM00015
IQ motif, EF-hand binding site4.6SM00015
IQ motif, EF-hand binding site4.6SM00015
IQ motif, EF-hand binding site83SM00015
IQ motif, EF-hand binding site83SM00015
IQ motif, EF-hand binding site110SM00015
IQ motif, EF-hand binding site110SM00015
IQ motif, EF-hand binding site32SM00015
IQ motif, EF-hand binding site32SM00015
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Leucine-rich repeat, cysteine-containing subtypeIPR006553
Y-scoreD-scoreY-pos
0.0640.09515
InsideOutsideTMhelix
1-449
*** None ***
PositionContextScore
96MLARAKR|IR0.59
233RGHRARR|HA0.533
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        3358 bases(100 bases per row)
ATGCACTCGTTCCTGCGCAACTTTCTCGCTGCCGGCGAAAGCGGACGTTTCCAGCAAGTGATTGACCTGCATCAGCACGGAATTGACACGGGGATCACTG
TCACAGACGCTACGCTACAAGAAGTGGTGCTCACCGTGCCAAATCTACGCGGGTTAAACCTCTCCGGTTGCTCGCATATTACGGATGCTGGTCTGTGGGC
TGTGGCAAGACACTGCCAAGCACAGCTGGACACCATTTACCTCGCCCAGTGTGAAAAGGTGACAGAGCTTGGACTCCGTCTTCTCGCTCATAACTGCAGA
CTCGTGTTAGTGGATCTCAGCGACTGCCCGCAGCTCAATGACGCCGCCCTACAGACTCTAGCTGCAGGCTGCTGGATGATTGAGACGTTCATAATGAAGC
GCTGTCAAGGAGTTTCCGATGCTGGCATTGTTAAAATCGCCCAGTGCTGTAAAGACTTGCGCCATCTGGACGTGTCTGAGTGCTCTCGACTGGGAGAATA
TGGCGACAAAGCGCTGCTTGAAATTGGGAAATGCTGTCCGAAGTTACGTGTATTAGATCTCTTCGGCTGTCAGCACGTGCATGATCCTGGCGTCCGTGCC
GTTGCGAAAGGCTGCCCACTATTGACCACACTCCGACTTACAGGATGCCGAGATGTCAGTAGTGTAGCCATTCGTGCGTTGGCGCAACAGTGTACACAAC
TCGAGGTCCTGTCCCTCTCTGGATGCATCAAGACGACCAACAGTGATCTCGAGCTGCTTGCTACCAACTGTCCGCAGCTCAAGTGGCTTGACATCAGTGG
AAGTCCAAATATTGACGCTCGAGGGGTACGTTCACTAACGCAGAACTGCACTTCCCTAACGTATTTGAGTTTAGCAGGATGTCAAAAAGTGGGAGACACG
GCGCTAAACGAGCTTACTGGTTCGGGAGCTGGAGGCCTGACAAAGTCTCTAGGAGAGTTAAGTCTGGCAGGGTGCCCTCGAGTTTCGGAGGACGGAGTGA
ATGCTTTGACTACTGTCTGCACCAACCTCATCACGCTCAACCTCACGAATTGCAAGCAGATTGGGAGGAGGTTCCTCCAGCGATTAATTGCCAAGCTCGT
ATTTGTGCAATGGGCCACGAGCTTCTTCGGGTTCGAACCACTGCCCAACGCCGCTGAGCTGTGCCGCCAACGTGATCTCCGCTTGTTGCAATTGCGAAGT
GCGATTAAAATCCAATCGGCCATCCGTGGCTGCCTTGCTCGTGGGGGACTATGGCAGGCGAAACTGAAGTATGTGGAGCGGAGGATCCTACCGCTGATCC
AAGCACGAGTTCGTGGGTTCCTAGTACGAAAGCGCCTTGAAGCCAAGAAGCGGTATCAGCTGGAAGATCAGGCAGCACGGCTAATTGCACGCGCGTATCG
GGACTTGCAGCTTCGTCGGATGTTGGCCCGCGCCAAGCGGATCCGGAAGATTAAAGAGCACGAGGACGAGGCAGCTCTTATCTTCCAGAAGGTCTTCCGA
GGCTATCGCGATCGCAAACTGGTAGCGAAGATGCGCTATGACATTTATTGCGAGCAGCAGTTCCAAGCAAGAGTGATGATCATGCAGAATCTAGCGGCCA
TCAAGCTGCAACGAGCTTACCGAGGCCACCGTGGGCGCTCTGATGCCACCCTATTACGCTCCATCAAAGAAGCCAAACGTCTTCAGCAGGAGCGAGAACT
CCGGTCTGCAGCGTATATCCAGCGGGTGTATCGAGGTCACAAAGGACGCAACATTCGCGCTCAACGTCTAGCGGAGTTGCTTCACCAAAGCCAATGCAAT
CAGGGCGCCATCCAAATGCAGAAGGTGTTCCGTGGCCATCGAGCACGACGACACGCTGTGCTTTTACGAGCTGAAGCCGACGAATTGCGGATACTCAATG
CGGCTTTAACTATTCAACGATACTGGCAAGGTATTCGAGACAAACACTTGGCTGCTGTGCTGATCGGGTTGATTAAGCTACGTGCACGTGAAAACGAAGC
CGCCAACTCGATCCAAGCCGCCTATAGAATGCACGCGTCTCGAGGATTCATGAAGGCCATGAAGCTGGCGTTAACAGCGCAATTGAGACGAGTGAAGGCA
GCAACAGATATCCAACGGCTCATTCGAGGCCACCGAGGACGCGGAGACGCAGAACTGCGACGAGAACTGCAGCGGTTCCGTCACCAAGCCAAGCCTTTGT
TCGCTAAAGAGGCTCGTTTGCAGGCGCTTGTGGACGACTTGAGTAATAAAGTGGAGCAACTGCAGCGCAAAACCACTGTCGATGAAGCGGAAGAGCGTTC
GCTGACGCTGGAACTCGAGAAAACGCTTCATATTAAAACCAAGTACCACGACTCGAGCCGCATCACCGGAACGCCTCAGCGCTATCTTACACAGTATCTC
CAAGTTCAGCTAGCGGACCAGCTACGGGCCAAACGAACCGAGATTGCGCTAGATGGACGTGCGTTTGAAGACCTGACCACAAATTTGAACGACGCAAAGA
AACAATTGCGAGGGGTTAAGCGGCAGCTCGAGCCGTTAACCGAGGGTGTCGTCAAGAAAACTCGAGAAAACCGAGTCAAGAGATTGCAGGATAAGGTTCG
ACACGAACGCCGTGCAGCTATCGCTATTCAGAGGATGTTCCGTGGCTTCCGCGTAAGGGCTGCAGTAAGAGAGGGAGGCAATTGCTGGATTCAAATGGCT
TCGCCCGATGGTCGACAGTATTTCTACAACGCATTGACGGGGGCTACACGATGGCATCGACCTCTAGCAATGGACATTTTTGGAGATGAATTTGCGGAGC
CCATGAGAGAATCTGTCGAAGCAGCAGACCACCAACCTCTTTGCAGCCACCGTATCATGCAAAGTACTCCCAGCGACAGACAGCCTGCGTCCAGTTGGTA
CGAAGCTTTCGATGACAAAATCCAAGCTCCGTACTACTTCAACAGCGAAACGAAAGAGTACCAGTGGGATAAACCTGATGCTATCGAGAACGCGTACTTC
ACCGACAGCCAAACGTCTCGAAAACGTCAGGAATGGCTTCAGGAGCAGCTACAAGACCCAGAAGGGCTCATTGCAACGACACAAGTGCGATTGCCTGTGC
TAGGGCAGTGGGAAAGGCGAGTCGATCCAGTCACCGAGTACATTTTCTTCTACTACCCACCAACTGGAGAGATCAAAGCATCGTTGTCTCCACGAAGTGT
CCACGCATCGTTAGGTGACACGACCATGAATTCGCGACGTTCAGCACGTAGTATTGGGACGTCTCGATCTCTGCATTGGCAATATCGATATGGCTATGAA
TATGATGCGAACAAGAAGCTCGTCACGAGCTCGAGGACTCACAGGCCGATTTGGACTG