Transcript Name :
Phypl_g47
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_259509
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain5PS51257
Serine/threonine- / dual specificity protein kinase, catalytic domain5PS51257
HECT75.742PS50237
HECT75.742PS50237
HmmSmart predictionP-Valprediction_id
HECT0SM00119
HECT0SM00119
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.4450.49634
InsideOutsideTMhelix
1-12
13-32
33-669
*** None ***
PositionContextScore
154RRARNRR|EW0.745
*** None ***
GO
Biological ProcessGO IDPrediction Method
ubiquitin-protein transferase activityGO:0004842IEA
*** None ***
*** None ***
Sequence
        2009 bases(100 bases per row)
TGGACGACGATCGCACCACGGAGGCGTCCATGCTGTACCAGGGCATCGGCATGCTGCTGCTGTGCGTCATCTTCTTCGTGGTGTGGCTCATGGCCTGTCG
ACGTAATCGCCACCTGCTCGACATGGAAGTCCCTTTGCTCTCGGGCGAGTCCGTCGACCATCGAATAGATGCCGCCACGCGAGAAGCAGAGGCGGGGTAT
ACAGTCTGCGCTAGCTGCGAGTTCGAGAACTTCAAGCGCTTCGAGTACTGCGTGCTGTGCGGCGACAAGCTGCCGTCTCTGTCCATCGTGACGGCGGACG
ACGAGAGCGACGACGAAGAGCAACAACACCATCACCTGCAAAGAGCAGAGAGCAATGATGGAGCTGTCAATATTGTGATACAACCGGCGCACTCGGTGTC
GCCGAGGCCGAGGAAAATGTCGTCGTTGAGTCGTCAGCAGCGACGCGCCAGGAACCGTCGAGAGTGGAGCCGGAAACTTGATGTGGAAGGGAACCTCTTC
TGGTACCGCAGTGGGGGAGGCAACGTGCCGGTAAGCAGTGAGGTGGACGCGCTCATGCCTGGCTACACGGTGAGTTTTAAAGTTTCCGAGGAAAAGGAGC
CAGAACGAGAGCAGGAGACGCCTGAAGGCCAACCTGAGGACGAAGGACAGGAGACTGAGCCCGTGCTCGCAGTGGAGCAGCCGCAGGAAGCCAAAGAGGA
TGATCAAGAGAAGCCGATATTGCCCACGGGTGTGAAGGTGGAGCTGATTGAAGCGTCAGCTTCCGACCCAGCGGAATTCCCCACCGGTAAGTCGGTGCTT
GCTGACGCTGGCCCGGAGCGACGCAAGGAGACGGTGTCTTTGGCCGCTAGCGACTTCCCGTCCAAGTATGCGCATTTTGTGGTCAGCACTGCCTCGCTCA
TTGTGCCTGCGGAAGTGGAGTTCTTAAAGCTGTCGGTGCACCGAGACTACATGATGGAAGAGTCGATGGACCACATGTACTGCATCCAGCCGAAGAATCT
GCGCTCGTTCATGCGTATCAACTTTCTGGATGAGAGCGGCGTGGACGCTGGTGGCGTACACCGCGAGTGGTTTATGCTGGTGAACGAGCTTCTGGCTTCG
CCGACCCTCCGACTGCTTAAGTGCACCAACAAGGCTGACCAGAGCTACTTCCTCAACCCGCAGTCTCTCGCTGAGGTGGGCGAGGACCACCTTGCCTACT
ATTTTGCCACTGGACGATTGATTGGTCGTGCTCTCCTTGAAGGAGGCATTTGGGGTTTTCACCTGGCGCTCCCGTTGTTGAAGGTGATCTTGGGTGTGCC
AGTGACTTTTGCTGATATGGAATATCTTGACCCGGAGTCGTACCGCAGTCTGCGGTGGCTGATGGACAACGATGGCGTGGATGACCTCGGCCTTGACTTT
AGTTTAACTGAACAAGTGAACGGATCTGAGAAGATAGTGGTGGACCTGATCCCGAATGGAAGGAACGTGGCCGTCACAGACGCCAACAAGCGCGAGTACT
TAAACCGCCGATTCCGCTACGTACTTTTCGAGAGTGTGGCCGATCAGATGTACGCTTTCCTGAAAGGTCTTTACGAGGTCATTCCTCGCGAGATGTTGCT
GACCTTCGACCCGGAAGAATTCGACTATCTGCTCTGTGGATCCCCTGAAATCGACGTAACGGACTGGGAGGCGCAAACTATAATGTCTCCAAACCTCGAG
GGTGCAAGTGTAACCCGGTGGTTCTGGGAGATCGTTCGTCAGATGCCGAACGAATACCGTCGACGTCTTCTGCTGTTCGCGACAGGCTCAGCGTGCGTCC
CGTTGTCGGGTTTCGGTGGCCTCACTAGCTACGATGGCCGACTTTGCCCCTTCAACCTCAAGGGTGTGTCGTACAAGATGACCCAGTACATTTCTAGCCA
CGCGTGCTTCAACCGGCTAGACTTGCCTCTATATCACAGCAAGAAGGAGCTGAAGACGATGCTGTACGCCACGCTGGACACAGATCTCACGGGTTTCACG
ACGGCATAA