Transcript Name :
Phypl_g38
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_542020
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Guanine-nucleotide dissociation stimulator CDC257.2e-20PR00419
Guanine-nucleotide dissociation stimulator CDC257.2e-20PR00419
Guanine-nucleotide dissociation stimulator CDC257.2e-20PR00419
Guanine-nucleotide dissociation stimulator CDC257.2e-20PR00419
Guanine-nucleotide dissociation stimulator CDC257.2e-20PR00419
Guanine-nucleotide dissociation stimulator CDC257.2e-20PR00419
Guanine-nucleotide dissociation stimulator CDC257.2e-20PR00419
Guanine-nucleotide dissociation stimulator CDC257.2e-20PR00419
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.1580.26833
InsideOutsideTMhelix
1-506
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1520 bases(100 bases per row)
ATGGCGTTCCTGCAGCTCCGTCGGTCGGTGCTGACCCGCTCCCAGCGCATGCTCGGTGCCAGCCTCGCACGAAGCTTCAGCTCTGCTGTTGATGCCCCTC
ACCGACGCGTGTGCGTGGTCGGATCAGGCCCTGCAGGCTTCTACGTCACCAAATACCTGCTAAAAGAGCACGCCAGCGCACGCGTGGACATGCTGGAGGC
GCTGCCCACGCCCTTCGGCCTCGTACGCTCTGGCGTGGCGCCCGACCATCCGGAAGTGAAGAGCGTCATGAATGACTTCGACAAGGTGGCAGCCGACGAG
CGCTTCCGCTTCCTGGGAAACGTGCGCGTTGGTGAGGACGTGATGCTCGCCGAGCTGCGACAGAACTACCACGCCATCGTATTGGCCTATGGAGCTGCAG
GAGACCGGGAACTGGGCATCCAAGGTGAAAACCTGCGTGGTGTCATGTCTGCGCGGACGTTCGTGAACTGGTACAACGGCCATCCGGCCTTCCGCGACCT
GGAGCTGGACCTGACACAGACGCAGACGGCGGTTGTCATTGGCCAGGGCAACGTGGCGGTGGACTGTGCCCGCATTCTCACCAAGGACGTGGACGAGCTG
GCTGCCACGGATATCGCCACTCACGCGGTGGAGGTACTGCGCAACAGCAGCATCAAGAAGGTCTATATCGTGGGACGACGTGGCAGTGCACAAGCGGCGT
TCACTATGAAGGAGATCCGAGAGCTGACCAAGCTGGACGGTGTATCATGTGTCGTCGACCCTGAGGATCTGAAGCACAGTATGACACCTGCGTCTGAGCA
GGAGGTCAAGGAACAGCGCGCGCGCAAGCGTATGAACGACTTGCTGGTCAAGGCCGCGGAGCAATTCGACAGTGCTGACGCCAAGCGTGTGGTGCAGATC
AAGTTCTTGAGCTCGCCGGCGGAAATCCTTGCAGATGAAAAGGATCCGAGTCGAGTTGGAGCCATCCGTGTGGAGAAGACGAAGCTCGAAGGCGAGTCGA
ACCGACAGCGTGCTGTGGGAACGGGGCAGTTCGAGAACATCCCGTGCAATCTTGTGCTGCGCAGCATCGGCTACAAGTCGCTGCCCATCGAGTCAGATGC
CCCTTTTGACAACCGTCGTCACGTGGTTTCGAATGACCAGGGGCGCGTGGTCACCACGGCAAGTAGTGGCGAGAAGCAGCCTGTGGTCGGCTTGTATTGC
ACCGGGTGGGTGAAGCGCGGTCCCTCTGGCATCATTGGCACCAACATTGTGGACGCTCGAGAGACCGTCGGTTGCATCGTTGAGGACTTTGCAGCTGGCA
ACTTCCTTCACAGCAACAACAGTGCCAATGAAGACTTGGGTGGACTGGAGACTGTGGAGAAGATCATTAAAAAGCGCAACCCGGATAAGCAGCTCGTTAG
ATGGGTTGATTATGAACGCCTTAACGCTGAGGAGAATCGCCGCGGCGAACTTGTTAGAAAGCCTCGCGAGAAGATCACGTCTGTAATCGAGATGCTGGAG
ATTGCCAAAAGTGCCAACTG