Transcript Name :
Phypl_g20
Orientation:
(+)
Number of Exons:
16
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
EF-hand domain12.728PS50222
EF-hand domain12.728PS50222
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0930.12329
InsideOutsideTMhelix
1-598
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
calcium ion bindingGO:0005509IEA
*** None ***
*** None ***
Sequence
        5667 bases(100 bases per row)
ATGAAGAAGAAAGTGCGTCTCTAGGCAGCGTCTCCAGGCAGCGTCTCCCTCCTACATGTAGCCCCGATGAGGTGTGTACTCACCTAAGAGGCGTCTGCTG
CCTGCAGGTTCTGTTGATGGGCAAGTCTGGGTCAGGCAAGACGTCCATGCGCTCCATTATCTTCGCCAACTACCTGGGTACTGAGTCCTCTGATGCTATA
GCTACACTACGGGCCTCTTAGTAACCATATCTCCCTCATCTGTGTGTGTTTATATCTAGCTCGTGACACAATGCGACTGGGGCCTACGCGTACGTGATCG
AGGCAAATGTAGCAGGGTTTTTTGTCCGGTTACAAGGTGATTCACAGGACTGTGGTTGCTACTGCTTGTAGTGGATGTGGAGCATTCGCACGTGCGTTTC
TTGGGTAATCTGGTGCTGAATCTGTGGGATTGCGGCGGGTAAGGCGACAGGAGAAAGCTCTTTTGCTGACACATTTTTTGGTGAGCTGACGGTACTGTGT
GCGGTGGTTCTTGAAGCCAGGATGCCTTCTACGAAAACTACTTTGAGAGCCAACGCGACCACATTTTCCGCAGTGTTGAGCTGCTGATCTACGTATTCGA
TATCGAGAGTCGTGAAATTGACGTACGATTTACCGATGGTTGAGGAATTGAACACGGCGATACTGATTTTCGTATTGACTGACCCCCTACAGAAAGACAT
GGCTCACTTCGATGGCTGCCTGGAAGCCATCGACCAGAACTCGAGTAACGCAAAGGTGTTCGTGCTGATCCACAAGATGGATCTGGTGCCGGAGGACCAG
CGTGAGCGCGTACGTGACGAAAAATGCCTCTTTTGAAGTGATAATGGGCTAAATAACTGTGCACGCTGCAGGTGTTCAACCAAAAGAAGGAGATGATCCT
GGAGCGTACGGGCCAGCTACCAACTGTGTGCTTTGGGACGTCCATTTGGGACGAAACGCTGTATCGCGCATGGTCGTCCATCGTGTACTCACTGATCCCG
AACATGCAGGACCTGGAGAAGCACCTGAACAGCTTCTGCTCGATCTGTAGCGCTGATGAAGTGGTGCTGTTTGAGCGTGCGACCTTCCTCGTGATCTCAC
ACGCTACACACACGAATCACCGCGACATCCACCGCTTTGAAAAGATCAGCAACATCATCAAGCAATTCAAGCTGAGCTGCAGCAAGACGCAGGCGCAGTT
CCAGGGCATGGAAGTGCGCAACGCGAACTTTACGGCCTTTATCGACTTCTTCACCGCCAACACGTACATCATGATCATCATGTCGGACGACTCGATTCGT
AAGTAGTTTTGGCAGTCACCTGTGTGGTTAGTTTGCTGTTGCTTACATTATTTTTTTCTCGTGATCGCGTAGAGCCGGCGACGATCCAACTGAACATCAA
GGCGGCCCGCCCTGTGTTTGAGGAGCACGTCCAGCAGACAAGTTAAGTGTAGCACAAGTAAGGACGGAGAATCGATTCGCAAGCCAATCGATAAAAAATG
CGTCTTCGGAGCAGCTAGGCTGGTGCAAATCTACTTCCAATGAATAAGGACCATGTGTGTGGGATTCAGACCATCTTTATTGCATATACGTGTCAAGAGA
ACTCCAGGATCTCTGCAGCGTTCGTCAGAACGAGAACATTATCAAAGAAGTTACTGTGGTGGCGGCGGCGGGCTTCGAGCAGACGAGTTGGTTGCAGCTA
GCATGTACCCCCTCCGTCTCAGTGCACGTAGAACCACAGGTGTAACAGCAAATGTCAACGGCCACCGGACTGGAGCCAGCACTTTGTAGAGCGTATAGGC
GATCAGGAGAGATCCGGCCGAGTTGGTGGTGGAGTCGCTGACCGACGAAGATAACCCCACTGAGTCCAGGATAGAAGTCACATCCACTCCACTCGATACC
CCCACATAGATGACGGAGAAGGATAGGAGAGACAGCACAATGTGCGTACAAATGCCTACACGGCCGTACTCGATTGCGAAGGTCTTGGCTCGTTGGCGCC
ACGACTGCGGTTGGGGCTCCCCTGTGGGCTGTTCCAGCTCCTTGTACAAATCTTCGTCACTCTGTAGTCATAGATAATTCAATACACACAGTCAGGTGAA
TCGTCAGTCTGCTACAGCCTCTGAAGATCCTTTACCTTGGCTGAAGACGGAGATGACGACGTGTGGTCTCCTCCTGTGAGCGGTGCCGTCTCCTTCGAGT
CCTCGGACGCCCTACCACTGGACCAGAGGCGGCAGTTAGCACTGCGACCCACAATAAACGACGACGAAGACCATGGGAAGCCCAGTACACGGCGCGACAC
AGTGACGGCAGGTAGCGGAGCTTGACGCCACGAGGAAGAAGAGACGCGGTGCACGCTGCTGTTAGGAGCCAGAGAAGACAGCGACCGAGCCGCGAGCACG
CGCGCATTCGAACACTGGAAAATGCCGCACTGCGTCGCGCCTTGCGTAACGTATAAGTACCTCATTCCACCGCGCAGCATCATGGAGAGAGGAGGCAACT
CAAGGCGATAATGACGACGACTATCATCACACCAAAATCCATCTGTGTAGTGCACACCAAACGCGACAGGTCAAATCGGACACGGCGTTTCAAAGAAGTG
TCCCACACCTGCCACTTGAAGAGCGGCGACGAGACGATGTCTTGGGTGCCGGTGCGCGGCCTCTGGGCAGCGCGTGGCGCGCTCCAGCGCAACATACGCG
GATCAGTAGCTACAGGTGCGTTTTGTCGACAGGTACTGCGGCCGACGAGCGCGATACAGTGTGCGTTATTGAGTACCAACAGCGAGAATGGAGACGTCCG
ATCTCCTTCGAACACGTCGAAGCGACACGAAAAGCCAACGCACCACCGTCAGCAGTCCTCATTTCTATGCAGCGTCGATCTGAGCAGCCCAGCAGCGCAG
CGTAAGCTGTCCAAGTTGATCCAGGAGGTGGTCAAGACGAAGGCCAATACCGGCGGTGCGGAATGGCGATGATGCAGAATAAAGAGGAACGTTGTTCTCA
TTTAGGACGTTGTTTGAGGCAGATTTCGTGCCGCAGGTGGTAATTGAGAGCCTCTGTACGACGTACAGAGGCATGAACATTGACGAGAAGAAACATTTTC
TACAGATATTGGCACAGGACTTGCACATTGACACTGTGGCGGTGGGTGCAGTACTGATACGGGTAGGCTTTGTGCCGCTATTAATTATTGTTTGCAATGA
CGTCTACACGTAGGCTCTGCAAAGTGCTGTTCAATTCGAGCAAAACATGGCCAACGTGAAAGACACTCGCAGCGGACAGGTGGATTGGGATCACGAGAGT
GTGGAGAGGTATTTGCGCACTTTCCGAAACCTCCGGAACGCACTATCACCACTATATGAGGTGATGAACGCTTTTGAGGCTTGCTAGTGGGTCGTGATGC
TGTAAAGCTGATAACTTTGACGCTTCCCCTTTTACGACGTAGACCTTTTTCCAGCAGATCCTGTCGCAACGAGAAAACGGCATGTTGTTTTTGGTGCACA
TGAGGGCAGACCTGCTGCAAGTTCTACGCAAGAACGCGACTCATTCCGAGATTCCTGCACTTCGCTCACTCGATGCAAGCTTGAAAGTGAGTTGTAGAGT
ATGATATGGTTCGCTACCTATTGCTAACATTGGACCTTGTTTATGCTTCTCAAAAGCATTTTCTAGCGTCCTGGTTTAGCGTTGGTTTCCTGAAACTGGA
ACGTGTGACCTATGAACACTCTCCTGGACAACTCTTGGAGAAGATCATTCGCTACGAGGCAGTGCACCCCGTTGGCACGATTGCCGAACTGAAGAGGCGA
CTTGGTAGGCTTTGACACAATTACGCGTGCAGTTTGAAGTGTGTTAATCTAATTGATCTCCGTTATTCTCAGGTAATGGGCGCCGTTGCTTTGCGTTCTT
TCATCCAAGGTAATAGCTCTGCAACTACCCATAATGCAACTCCCAAGCCTGATTTCCTGAATGTGCGTTCTTCATTGTAGTATCCCAGACGAGCCCTTGG
TTTTTGTGCATGTGGCATTAATGCAAGAGATCGCGTCTAGCATGCAGTCAATTCGAGAGGAAACGGAGCAATTGGCAGAATGTGGCCAAGCAAAAGCTGC
AATCTTCTACTCAATCTCTTCGACGCAGAAGGGACTTTCGGTATGTTTCCCAGATCGACCATTCTCGGCAAGATAACTAACCATATACTTTGTTTATCGG
CAGGGTGTGGATTTGGGCAACTTTCTCATTAAAGAGGTTGCAAAAGCACTAAAGACAGAGTACCCGCATCTGAAAACATTTGCGACCTTGAGTCCTCTAC
CCCAATTCATACTGTGGCTCGAAACCCAGCGGTCAAAGACGAATGAATCGTTAGTCTCTCCGCTTGAGCTGGATGCTTTACTCGACGTCCTCGAAGAGCG
TGGTACTACTGTTCACTCGGATTCGACTCCTGTGGCCATCGTTCTAGATGCGCTTTCGATCAACAAGTGGAGTGAAGATGCGGCGCTGACCGAGGCGTTG
AAGCCTATCATGCTTCGACTTGGCGCGCGTTACATCTATCATGAAAAGAAGCGCGGAAAAGCGTTGGATCCCGTTACGAATTTCCATGTCCGAAATGGAG
CGATCTTTGAGCGGATCAACTGGCTGGCAGACCTGTCCAAGAAGGTGCGTACAGTAGATTAGCCTGTGAGTATGAAATTTACGGTGTATTAAGGGACTCA
CCGGATTCTTTCGCATTTACTAGGGGCTTGCCCAAAGCGCCGGGATGATGATTAACTACAAGTACGACCTGGCACATGTGGATGCAAACAATGAGAACTA
CTTGCTACACAACATTATACCTATCGGACTTCAGCCGCAGCAAGTGCTTGGGGCACGCACCATCTAAATGAGAAGATGTGGTGACATTTTGTTGGTAGTG
ATGGTGAAGAATGCAATTCAGATTTCGACTACTTCTTGGTACATTTTTGGAGTTCTGTGAAGAGTCGTACAACTGAAGCTGTGAAGTCACGATGGTACTC
GCACAAGATGAGATCGATGCTTGCCGAGAGGCATTCCTGGCCTTCGACAAAGACCGGTAAGTGAGCTGCACACGAACTTGCGGGTATTAGTAGTCAATAA
CCCTGATATTGCCAGGAGTGGCACAATCGATGTCTGGGAACTACGGCAGGTGCTCGAAGGTATACACATTTTCTCTTCTGCAATGTCTCAACTTAACCAG
CCGGAATGTATTAGCGATGGGACAGCAACCAACCGAGGAAGAATTGTTCCAGATGATCAGCGAGGTTGACGAGGATATGAGTGGTGCAATAGGTATCTGT
GTTTATCAGTGAGTTTTGTAAGGATGCTGAAAGTTCACAATGTCCGTTAGACTTTGCGGAATTTCTGCAGGTCATCGATAACCAAAAGGATCGTGCCGCT
ATGTTTGAAGATGATAGCGACATGAGTAAGTACAACATGCCCTTTGAATTTCTCAATCTATTAACATATTTTAATTTCCCCAGTTGACGCGTTTGTTGCA
TGCGGCGGTAAGCCAGACAAAACTGGGTTCGTGCGCAAGGAGACGTTGGTGAAAATAATCAAAGGCGACTTCGGCCTGACCATTAATATCGAAGAGATGA
TCAACAAGCTGGATGTGGATGGAAGCGGAGAGATCGAGTTCGACGAGTTCAAGGCCATTCTGACCTA