Transcript Name :
Phypl_g19
Orientation:
(-)
Number of Exons:
3
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.1190.08827
InsideOutsideTMhelix
1-238
NN-scoreoddsWeighted Score
0.625.8150.012
PositionContextScore
88SDKRVRR|AV0.734
TypeScore
cytoplasmic69.6
GO
*** None ***
*** None ***
*** None ***
Sequence
        1803 bases(100 bases per row)
TGCAGAGCGACCGCAGACGAGATTCCTTCCACAGCGCGCAGGTCCTGAAGAGCCTTCGACGTCAAGACGTCGAGGCAGACGATGTGAGTCCGTTGATTGA
AATCATTTACTGGTCCCCCTTCGTAGAAGTCCGTCGTGACGCTGCTGCTGCAATTGCCTCTCTGAGCCGCAACGGTAAGTTGTTTTCAGTGTATGAGGCA
ATGGGCTCACTCGTTTTTGTATGCCAAATAGCGGCGAATCTGGAGCTCTTGGATGAAGTAGGAACACTCGGAGCGATTCTGACAATGTTAAGCTCCCCAG
TAGATCGAGAGGACTCAAGCATTTCCCACGACTGCGCTGAAGCACTTGCGGCTCTTGTGCGACTGTCCAGTATCAAGACGAAGCTTCTCCTAGCTCCAGG
TGGAATTGACTGTGTGTTCTCGTTGCTGCACACGACAACCGATTCAAAGTTGCGCTTGGCAGGTTTCGAGATCGTCTCTCGACTGGTAACAGCTGACGAA
TGGAAAGAAGCCGTCGCCAAACGCGAAGGCTTCGCGTTCATATTGAATTGCTGCTCCGGCAGTGGCGCACCGCAAACCTCTCGGGCTGATGCAGGCGATT
CTCGTACTCGAACGTTGGCAGCCTCAGTACTGCACCAACTCGCTGCCTCGTGCGATAACAGACTACTATTTTACTATTCAGGCCACTTTACGACACTGTC
GGGGCTGCTGCGAGACCCATTTCTGGATAAAGACGCCATCTTCCGCCGTGAGTTGCTGAGTTTTGTGCACTTGTTGCTCTCGGAGACCGAAAGTGCTCGA
CGTTTTGCTTCAATTGGGCTGTTACCATGTGTACTTGGCGTGCTTGGTCGCGGACCATCCAGCACCACAAAACCTTCGCTTCAAGTGAGTTTGCTTGTCG
TAGCCATCATTGATGCAGTCGCGAAGGACGACGTTAACCACCAAGCACTTGTGCAAGCAGAAACGATGCCGCGTCTTGTCCAGCTGTGCTTCTCTTTCAA
CGCGGGTGTGCCAGTTGCTGATCCCGATAAAAAACGCCCACACACTGCACGAGCTCAGTCCAAAAGGTTATCCACGCGGCCTAGATCAGCTTCGTCTACT
TGCCCCCGCTCGCGTTCATCGACCTGGTCAGCTTCAGAGGCGTCTGCAGTGATTCGCGCAACACTTGGGATTTTCTGTTCCATGGCGAGGAATCAAGCGA
ATCGGGAGCACGTCATTCGATCCAAAGTGCTGGATCACATCGCAGCTCAAGAGCTGTACGCTTCGTCTGATAAGCGCGTTCGTCGTGCTGTAATCACTCT
GCTCACTCTGCTCATTTGCACCGAGCGCAAGCGTCGTCACGAGGCTGCGAAGACCACGAGCATCGACCATGAACTTGCTACAAGCACACCCGCACCTTCG
TCCGATTCAAACGAAGCTTCTGAGCACGATTACCAGCACTACATCGAGCTGCTGGCTCGTGGCGTCGTCAAGTGCTTGTTCGGCATCCTGGCAGGCGATG
ACTTCGGCATGAAAGTGGATGCGCTGGGTGCTCTGGCTCAACTCACTCATGACGCACCGTCCCGACTGACGCTATGTAAACCTGCGTTACTGTCAGCATT
GGGGCAGTTCGCATTCCATCCGCTCGGTTCCACGCGGCTCCATGTAGCTCAGATCATCGCCAACTTTGCCGAGCGGCCGGAGAATGTGTTGAAGCTTGTG
GATGCGGGGCTTCTGCCGGTCCTGATAAGGTATGTAAGTCCTCTGGATCGAACTCATACCGTTGGTCACAGCAGTGACAAAGGCATGGGCGAGGCTTTAC
TGA