Transcript Name :
Phypl_g31
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_496973
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.3890.59624
InsideOutsideTMhelix
1-9
10-30
31-36
37-59
60-95
96-118
119-204
205-227
228-241
242-264
265-270
271-293
294-296
297-319
320-353
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1061 bases(100 bases per row)
ATGGACCCTGTGGACGAATTCAAGTTGGCTGCGGCCCTCTTCATCTGGGTGTTGGCGCTCGTTGGCGGCATTGCACCATTGCTGAGCAGCCAGCGCGTGA
GCAAGCGAGCCAGCAGCGTTCTCAACATGGTGGCGGCCGGCATCTTCCTCGCCAGTTCATGCATGCACCTGCTGCCGGACGCGCAGAACAATGAGGCGCT
CACCGAGTGGGGCTGCGAACACACGGCTGAGGTGTTTTTGGCCGTGCGCACGCGCTACCAAGGCGACAACAAGCGCTGCTTCAAGTGGGCCAACTTCTTC
TATGGCTGCGGCTTCCTCATGGTGTTGCTCATTGAGGTGCTCGCGCACACGCTCCAACGGCACTACGGCAAGGTGCATGGACACGGACACGCCCATGGCA
CAGAGCAAGAGCGCGACTCGCTGCTTGCGATCGAGGCCACGCGCGCCGCCGAGCTGGACAACCTGGCGAAGACTAACGGACACTCGCACAGCCACGCTCA
CGGCCACGCACATGGCCAACTGGAGACTGGAGACTACGGAACGCAAGGAGAGGAGACTGAGCTTACTGAGCATGCCAAAGGTGGAAAGGAGGAGCCGCAC
TCGCACATCCACGGCATCGTCAAGGGTAATCCCATCCTGGCGCTTGTCGTGTTCATCGCACTGTCGTTCCACTCCGTGATGGAAGGCATGGGAATGGGAG
CATCGAGCACCCCGGCCTGGGATATCCTCGTTGCCATTCTGGCTCACAAGTCGCTGGCAGCATTCGCGCTGGCACTTGAGTTCCTGCATCACAATGTATC
TCGGAAGCAGCTCCTGTCCTCTGTCGCTGTGTTCTCGCTCATGACGCCGGTTGGCATCCTTTTCGGCCGGCTCCTCGTCGACACGAACCACGCGACGCCC
GCAGGTGGTGTCTGTGCTGCCTTCGCTGGTGGCACCTTCTTGTTCGTTGCCATCATGGAGATCATCCCACAGGAGCTGCAGGATCCGCGCTATCAGTTCG
AGAAGTGCTCTGCTCTGCTCGCCGGCTATGGTGCCATGGGCGTCCTCTCCCTGTGGACATA