Transcript Name :
Phypl_g29
Orientation:
(-)
Number of Exons:
2
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0370.1322
InsideOutsideTMhelix
1-186
NN-scoreoddsWeighted Score
0.8442.3960.005
*** None ***
TypeScore
cytoplasmic52.2
GO
*** None ***
*** None ***
*** None ***
Sequence
        875 bases(100 bases per row)
TGTTTAAGATGGCGACGCCGACTCCTCCGGAATCGCTTGTGCAGTATGGTGACCCGATCTTCACGGGCGAGACACTAGACCCACCAAAGAGGGCCCCGGG
GGTTGTGAACGCAGGATCTTCCTCCAACTCAATCACCGCTGCGACTGTCGTCGCGGCGTCGGAATCTACTGGGTCTCCCGCCAGCAAATGCTCCGATGGA
GTTGCGCGAGTTGAAGATATCCTAAATGCCGTTCTACCTCCGCAGTACGCTACCATACTATCATGTCTGGTACTGATGATCTATTAACCGTTGGCTGCTG
CTAGGATGTGGTCCGAGGAAAATTCAGGTTTTTGGCTTCGATACGCATCTAGCGTGCCCTCGACTCGCTTCGATGTACTGAAATTGCAGGAAGCACTTGA
TGCCAAATTACTGCAGCGCCAGGCTCGTGAAAGCGGCATTTGCCCTGTTCGAGAGGATCTTTACGCCCAAGCTTTCGATGAGCTCATCCGGGAAGTGACA
CTGAACTGTCCCGAGCGAGGGCTTTTGCTGCTTCGTGTGCGTGACGAGCTTCGCCTCACGACGGATGCCTACAAGACGCTTTACGACTCGAGTCTGACGT
TCGGGGTACGGAAGCAACTGCAGGCTGAAGATGGCATGGGCGACTTGGCGGAGCAGATCGCCAGTCTTCAACGTGAGAAGGAGGAGAGCGAGAGCAAAGT
GGCTGAGCTCACCAACAAGCTCGAGGTCATTGAGAAGCGAGCAGCGGAACGGAAGGCGCTACAGGAGAAGAAGTTCAAGGAGGAGCTGGACTTCCTCAAG
TATCAAGGCCAACACCTTGATGCCTTCCTCAAGTCTGCTGGAGGTGGCACCACTGGTGTTTATGCGGCGAAGTAA