Transcript Name :
Phypl_g8
Orientation:
(+)
Number of Exons:
5
Description :
ABC transporter ABCF family
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
ABC transporter-like15.086PS50893
ABC transporter-like15.086PS50893
ABC transporter-like13.079PS50893
ABC transporter-like13.079PS50893
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain0.00011SM00382
AAA+ ATPase domain0.00011SM00382
AAA+ ATPase domain0.0000031SM00382
AAA+ ATPase domain0.0000031SM00382
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0650.04327
InsideOutsideTMhelix
1-795
*** None ***
PositionContextScore
194KEPRVKR|ER0.521
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
ATPase activityGO:0016887IEA
nucleotide bindingGO:0000166IEA
*** None ***
*** None ***
Sequence
        3239 bases(100 bases per row)
ATGAACCGCATTTTCGGCAAGAAGAAGCCTGAGGCGCCACAGGTCAATGTCTCCGATGTGGGAGGAAAGGTGGACGCCCGGGTCACCGACCTGGACATGA
AGGTGTGTAGCTGCAGCTCTAGTTGCTCAGTCGCACGGGGAGCTCCGCGGGTGCTGACTTGTTGCTTTCGCAGATTGAGAAGCTGGACCAGGAGCTACGC
AAGTATCGCGAACAGATGAAAAAGACGCGAGGCCCCGCTGTCAACGCCATTAAACAGCGAGCCATGCAGACGCTTAAACGAAAGAAGATGTATGAAGCGC
AGCGCGATAAACTGCAGGCCCAGTCCTTCAATATTGAGCAGGTGAGTGGCCATGGTTATTGCCAACTACTTGTTGAGTTCTGACGCCTGGCTTTAATGTA
CAATGGTTGTGCTCGTGTAGGCGGCATTTGCCATTGACACATCAAGAGATACGATCTCTACTGTGGCCGCCATGAAGAGCGCAGCAGTGCAGCTAAAGGC
GGAGACCAAGCAAATTGATATTTCCGAGCTGGAGGTGGGTTAAGAGCAGGAAAATATTGTCTACTGGTATCGATGGATCCATTGTATTGTTGGGTGTCTG
TAGGACGTGCAAGACGACATGGCTGACCTCATGGAGGACATGAACGAGATCCAGGAAATTATGGGCCGCTCTTACGGGCACGTGCACGCTGAAAATGCAG
CTGTCACCCAAAATGCTCTGCTCACAATGTTGGTGCTTTCGATTTTGCAGTATTGGTGACGAAATCGACGAAGACGAGCTAGAAGCGGAGCTGGAGGGAC
TTGAGGAAGAGTGGGCGGAGGAGGAGGCACTAGGAGAGGATGCAGAGGCGGCTCCATCCTACCTAACGTCCGCACAGCACCACGAGTTACCTGCCGCGCC
TTCGGGCGCCTTAGACTCCGGCAGGACGGCTCGCGCCACCGACGAATTTGGCTTGCCCGTGGCATCGTATTCGACGTAGCACCTTCAACCGGCAGTAAAC
ACAGCTTTCCAACGTGACACCTGCAAGAAATCCTGCCGAAAACAATCTATCAGCACCCTCGACTCCATCCGTGAGCCACCATTGTGTCAAATGGGATAGA
TGGCTACATCTGCACGTCAGTGGACCCACGCGATTGGCCAAGCTTAGACAGCCAATCGTTTCTCAGAATCAAGTTTAGCGGGTGGCAATCATCTTGAACA
GGATATATAATTTACAATGTTTTGGTTGATCCCCTTGTAAAGACCTGTGATTGCATTGTACAGAGTCTCACAGTCAAACGAGGTTTTAATCACATCGAGG
TTTTACCTCCTCTGCGCCACGCATTTGGTCGGCTCACTTTTGGTATTGGTGGTTTTGGCGCACAGCTTTTCGAGATCCCAAGAAGCAGCACAGCAGCCAT
GGCCCGCGAGAAGAAGGAGCCACGCGTGAAGCGCGAGCGCAAGGGTAAGAAGGAGTCCCGCAAGAAAGCTGCCGAGGAGAAGAAGGCGGCTGAGAAGGCC
GAGGCGCTCGAGAATATGTCCCACGCCGACCGTCTCGCCGAGGAAGGCATCATCGCCACCTGCTCACACAACGTCCGCTCTGTGCACAAGAACTTCAAGG
ACATCAACGTGCTGAACTTCAGTATCACGTACTTCGGCAAGGTGCTCATGGAGGAGTGCGACATCTCGCTCAACTACGGCCGTCGCTACGGCCTTATCGG
TCGTAACGGCTCTGGTAAGTCGACCTTCATGAATGTGCTGGGCGCACGTGGCATCCCCATTCCGGAGAGCATCGACATCTACCACCTTAAGCACGAAATT
GAGGCTAGCGACATGACGGCACTCGAGGCCGTGCTGTCTGTCGACGAGGAGCGCAACAAGCTCCAGGCTGAAGCTGATCTGCTCTCGGAGCAGATGACCG
ATGAGTCTATCAGCGAAGAGGACAGCGAATCCATCTCGGACCGTCTCACGGACTTGTACGAGCGTCTGGATGACATGGATGCCGCAACGGCTGAAGTCCG
CGCTCGCCAGATTCTGGCTGGTCTGACGTTTTCCGACGCCATGATGAACAAGAAGACCAAGGAGTTCTCTGGTGGTTGGCGCATGCGTATCGCTCTGGCC
CGTGCCCTTTTCATCCAGCCGACGCTGCTGCTGCTTGATGAGCCTACCAACCACTTGGACATGGAGGCCGTCGTGTGGCTTGAGGACTACCTCGCCCGCT
GGAAGAAGATTCTGCTCATGATTTCGCACTCGCAGGAGTTCATGAACGAGGTCTGCACGAACATCATTGACTTGACCAACAAGAAGCTCGAGTACTACGC
TGGTAACTACGACACGTACGTTCGTACGAAGGCCGAAAAGGAGGAGAACCAGATGAAGCGTTACAACTGGGAGCAGGATCAGATCAAGCACATGAAGGAG
TACATTGCTCGTTTCGGTCACGGTTCCGCCAAGCTGGCTCGCCAGGCTCAAAGTAAAGAAAAGACGTTGGCCAAGATGGTGCGTGACGGTCTTACTGAGA
AGGTCGAGTCGGAAATGATTGGCGACTTTAAGTTCCCTAATCCGGAGCCGCTGCCGCCTCCGGTTCTTATGTTCCAGAACGTGGCGTTTGGTTACCCGGA
CTGCCCGGTGCTGTACTCTGGCGTCGAGATGGGCCTCGATCTGGACTCGCGTGTCGCCCTTGTTGGTGCCAACGGTACGGGTAAGACCACGCTGCTGAAG
CTTATCACAGGTGACCTGGTGCCTGTTGCCGGTAATGTTCGGCCACACAGCAAACTGCGTATTGCTCGTTTCAGCCAGCACTTCGTCGACGTGCTTGACT
TGGAAAAGACGCCGCTTGAGTACTTCCGCTCCCTGTTCCAGACCAAGTCGGTTGAAGATGTGCGTAGCTACCTTGGTCGCTACGGCATTACCGGCGAGGT
GCAGACACAGATCATGGGACAGCTGTCTGACGGTCAGAAGAGTCGTGTTGTGTTCGCCTACATGGCCCAGCAGAACGCTCACATGCTGCTGCTTGATGAG
CCTACGAATCACTTGGACATGGAGTCTATTGATGCTCTGGCCCGTGCTATCAACAACTTCAGTGGTGGCATGCTCCTGGTTAGTCACGACATGCGATTGA
TTTCTCAGGTTGCCAAGGAGATCTGGCTTGTGGAGAACCAGTCTATCCGAGTGTACCAGGGCGAGATTTCGGACTTCAAGATGCGTGTGCGCAAGCAGCT
TAAGCTGGCGGACAAGGAGCCCGTGCAGACTAACGAGTA