Transcript Name :
Phypl_g41
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein PHYSODRAFT_285506
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0770.10357
InsideOutsideTMhelix
1-77
78-97
98-115
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        419 bases(100 bases per row)
ATGTCGACCAAGACTCTGCAGGGAGACCCGCGCCGCCCCGGCGACTTGCACCCGTTCGTGCGGGAGCAGCTGGACCCGGATGAGGCCCCTGGCGACTGGT
ACGCCTTCCTCTCGCTCGTGCTGGGCTTCCTCGCCTTCACCATGAAGGTACGTCGCTCTATGCGTATTTCTTACTCTAAACTAGCACTAATTCCTGCTTT
TTGTGTGTGTAAACCACAGTGGAAGGAGCTGGCCTGGGGCTCACTACTGCTGTGCGTGGGATCGTTCACCAACATGAAGTCGCAGGACATGAACACGACG
CAGGTGGCCATGTCCTTCTTCTTCTCCACTTCAGCCCTCGTGTCCGCCTACATGGGCGTTATGCGTCCAGGAATGCCCATGCCATCGTCGGCCCAAACGG
TCGAAGCCCCCGCGTCGTA