Transcript Name :
Phypl_g6
Orientation:
(-)
Number of Exons:
5
Description :
conserved hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.1220.10243
InsideOutsideTMhelix
1-547
NN-scoreoddsWeighted Score
0.5161.70.003
PositionContextScore
190SPARMLR|AL0.539
TypeScore
cytoplasmic56.5
GO
*** None ***
*** None ***
*** None ***
Sequence
        3379 bases(100 bases per row)
TGACAGGTCCTTCGGAGGCGTTGGCCGATCGGAATGCCGAGAGGAGCAAGACGCTAGACGAGACGAACAAGGCGCTGGCCTTCGACATGGGCATTCGCCT
GTGGCGCGTGGAGGTGGCGCTTGCTGTGCGGAAACTCTTGTCTCTGGGCCGCGCCTACGAAGTGCATTATTCGCTGCCTCGCGTTGCTATTGCCGACCTG
CAGTTATCGTCGCACTTCGGCCTCTCCGTTGTGTCTCTAATGCACACACACGTGTTCCAAGTGCAGAAATGCGAGACGCCCAAGTACCCGATGGAGTTCG
TAGACAAAGCGGCTCAGGGATCCTCCGCCCCGATCTTTACCGTTAAACCGGACGACTATTTGGTGGGCATGGACCTGGAGGATTTCCTCATCTGTCCACG
CAAACTGGGCCAGCTCCACAACGATGTGGAGGCTGTTGGGAAAGAGGTCCACATCAAGCAGGAGCAGGACAAAACGTCCAAGAGGACGGTGGTGCTGCGC
TTCGTGCGCATTGGCGAGTGGGTGGAGCCCGGCCCGGAACCCGAACGCTCTCCGGCCCGTATGCTCCGTGCGCTGGACGAGATTATGACTCACCACAACC
AGCTACTTCAGCGCTATGAGCTTATGGTGAAGCAGGACCGAGTGACGGTAAAGCGCCTGAAGTCAGCGGAGAAGTTGCTGAAGTACGTAAGGATCATGAC
TGGAGTCACGAGAAGCGCCCTCATGGAGAGCCAGATGTTCCAGTTCATCGACAAGTTCCAGAAGTGGTATCTAGCCATCACTAATGATGAAGAGAGAGAA
GTTGGTCCAGCCAAAGATATCGTCATGGAAGACGTGGAGGAGCCGGCGGAGGACATGGAAATGAGCCCAGAGCGACCTGAAATCGAGTACAACATCAACT
CTGCTACCCGACCCAACACTGCGTCAATACTGCGTAAATCAAGCTCGCAGTCCGGACCAACTCCTACTGGAGCAAAGAAACGAGTGACGTTTGCTGCGGA
TGTTGGAGCGCCTGAAGAGCCCGACCCAGCAGACGCAGACATCCCAACTCCGACTCCTGCTCACACTGAACAGGAAGTGCAGAATGAAGCCACTACAGTT
AGCAAGCCCAGGACCTTCGGTGTTGATGAAGGCCAGGCGTATCTGATGGCCTTGGTCAGCTCCAGTGTTGACCTTGTGTCGTCACTTGAAACGCTTTCTA
CTGCTGTTCAAACGGTAGCATCGTTGGAGATGAGCAGGAACTTCCCGGTGTTTGACGGTCTTCGGGTGCGTTCCCTCCTTTTACTGTGATGCAAACGGCT
ATTGCGACTGACAATTTCTTGCAGCTTCGGCGTGATTTACAGCTGGTTGGGCCGTCCCAGTATACAGCATGCGTCAGACTGGGGCATTTATCATTTGATT
GCACGGCTACATTGGATCGCGATGCCGTTATTGGCGCACTGTCGAGGCTGACCAACGCTGTGAAAGAGGAGCAAAGACTGTACATTGATATGCTGACATA
TTTGAAGGCTCAATTTGGTTTTTGTTCGTCCAATGACACCCGGAAAGTGAAGGATACGACCTTCAACTACCTCATTTCTAAACAGATTGTGCGGGTACGT
TTGCTTTCTATCTATTGTGTTCTAGCGGCTTCATGAGGCTAATACAGTGCTGCTGTCTATAGCTTCATGAGAAGCCTAGTGGAGATCCTGACAATGTCGT
GTACGACGTAGTGGCGCTCATCCAAAAATGTCCTCTCGTTTATAGGCGGGGATCCTCTTTACCGAGCACGAAAGGAGAAGTTGTTGACGCTCTAATGCTA
TTTCTAATGGCACTACTTGAGCAGCTCGAGGAGAGTCGGGCCTGGGATCGTTTAAGCCAGACCAAGAGAGAAGTTGAACCCACCGTAGACGAAAACACCG
AACACAATGAAGAAATCAGGTATGATAACAGTGAGGCGGACGACTATGCCATGGATAATGCCCGCGGAAATTCTGGAAGCGTGCAGGATGGTGGCGACAG
GAATGCAGAGTTGCGGTCTATGGGTATCTTGCGAAAGCGTCAGTATGCTCCGCATCCAGAAGAAAGTTGTGAAGATGATCGTGCTGCCCCTCGACCCCGG
TTGTCGTACTCAGCCGCAGAGCCACAAGTGTCGGCTCCGATCGAACAAAGATACACTGAGAATGACGGCGGGTGCGAGGCCGAGGCAGACACTGCAAATC
TGTTCATTGAGGACCGAAGCGGCTCGGATTCTAGTCGTTACGCACCAACCCGTTCGGAAGATGCAGTCGCTAAGGCGAAATCGGATGTGTATCAGGAGCT
GTTGATACTTCTCTTCCGAGATCGAGAAAAAGTAGTGAGGGCTGTTCAAGGGATCGTGTGGGATCTTAGCGTTACGTCTGAAACAACTCAGCTTTCGTCA
ACTTTCACGGTAGGTTCTCGCGTTTAACTTCATCTTGTTTGGTTTAACGAGTGCGTGATGTGAGGTCTTTAGATCTACAGGACTGCAACACAGCAAAGCA
ACGGCCTTGTCCGATGCGTTTTCAATGTGACTGAAGGCGTGGTCGAAGTATCTGCAGAAGGACCATCCATTGATATCGCGAAGGATAAAGCAACCGCGAT
CCTGGTTGACACGTTGGATGGAATTATCAAGACGTGGAAGAAGCTACTTGCCACATATGTCAGCCGACTAAGTCAAACTCCTACAACTTTGATGGCGGGG
AACGAAACTCAGGCGAAAAATCACGACAAGGTATTGTCTGTCAAATGTTTTACTTCGCGGAAGAATTGGTTTTGATGGCGATTGGGAAACACGAAGCGGC
TAACAATCCGGTTTATGTTGCAGGTGTCGACTGCAGAAAAACTTGTTCCACCCCTGTACATGTACTTCATTAAAGTCCGTGATACGCTTGCTATTTCGAC
GGCATGTCTAAACGCGAAGGATGCCAAACGGTCTGCCAATGAACGGTGGCGCGACATTTTGGAGTCGCTGAACAAGATGAAATCAGGGCCTTCATCCTCG
TGCGCTTCAAACGGAAGCACACACGCAGCAGTAGCACAATCTACGGCAAACAGAGCCGCAGCAGCAACTCCAGCGAGGACAGGCAATCTAATTTTATGCA
GTGACGATGAGATGGATGACGATGATGATGGTTATGATGACTACTCAGATGGCGGCTTTGATGATGATGACTGGGATCCATCAGGGGTTAAAACGACCCA
AGATGACCGCGCTGTGGCAGAGGAGAAGGCAGCTTTTGAGCGTGAGATGGCCAAAGAATACGAGGAAAGATCTGAGAGTGATCAGTCTGACGACGCCAAA
TTTCGTGCCGCAATTCGAAGCCTGTTTACACCTACTGATGACCTCTGTGCTGGAATTAACAGACTTCGGGCATCTTTAA