Transcript Name :
Phypl_g21
Orientation:
(-)
Number of Exons:
11
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
Protein phosphatase 2A, regulatory subunit PR550PR00600
*** None ***
HmmSmart predictionP-Valprediction_id
WD40 repeat18SM00320
WD40 repeat18SM00320
WD40 repeat13SM00320
WD40 repeat13SM00320
WD40 repeat0.33SM00320
WD40 repeat0.33SM00320
WD40 repeat55SM00320
WD40 repeat55SM00320
WD40 repeat46SM00320
WD40 repeat46SM00320
WD40 repeat7SM00320
WD40 repeat7SM00320
WD40 repeat0.16SM00320
WD40 repeat0.16SM00320
WD40 repeat55SM00320
WD40 repeat55SM00320
WD40 repeat46SM00320
WD40 repeat46SM00320
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0260.02924
InsideOutsideTMhelix
1-930
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
protein phosphatase type 2A regulator activityGO:0008601IEA
protein phosphatase type 2A complexGO:0000159IEA
signal transductionGO:0007165IEA
*** None ***
*** None ***
Sequence
        4657 bases(100 bases per row)
TGACGCAAGCAACGTTGCAGGGGGAGATCGGAGGAGAAGAGGCGCGAACGGGAGCAATGTCCAGGCTCAAGCACACCAACGCTGGCGGGTTAGAAGTCAA
CATGGCAGAACCCACAAACGAAGCTGATGCAGAGTGGGGACAGGTCTTCTCAGCGGGTGAGAGCACACGCAGCTTCGTGGAAGGTAGGGCTCTACCCTTG
TAGACGGAGATGAATTGTTGTTAAGTACTTCTTCATCGCCAATGTCTTTGCAGCTGAGGTGATTTCTGCGATTGAGTACGACAGATCAGGCGACTTTCTA
GCCACTGGGAACAAGGGGGGGCGAGTTTCCATCTACTGCCGCCATGGAACTCCTGCATCGGTTAGTGCACTACTTAGCTTCTGCTTTGTGGTCTTAACAC
TAATGTTGTATGTGTTTGGTGGCTATCAGAACCAAACCATGTACAGCGGGGTAAACACTGATCCGCAGTACCAATTGTACACCGAGTTCCAGAGCCACAA
CGCTGAGTTTGACTACTTGAAAAGCCTCGAGATTGAGGAAAAGATCAACCAGATCAAATGGTGCCGACCCGCCAATGGATCCCAGTGTTTGCTGTCCACA
AACGACAAGACTATTAAGCTCTGGAAGATACACGAGCGGAGCGTGCGTGAAGTCACAACGTACAACGAACAGGGACTTGCTCACGTGCCACGGACCCACA
TAACATCGGAGCTTATTCGGTTGCCACAGACGCATGTTCGTGGGCAGGTTACGACAACCACAGCTAAACGGGTCTACGCCAACGCGCACACGTACCACAT
CAACTCAATCGCCATCAACAGCGATGGGGAGACGTTCATGTCGGCAGACGATCTCCGGGTCAACTTGTGGAGTCTTGGCGTCTCGAATCAAAGTTTCAGT
GCGTGTTTGGCACGGGACGTGCGGTTGATGATAACAGCACTAACTAATGATTTGTCAATAATGGTTTGCAGATATCGTGGACATCAAGCCAGCCAACATG
GAAGAACTTACTGAGGTCATCACAGCCGCGGATTTCCACCCGACACATTGCAACACGATGATGTATAGCACCAGTCGCGGTGCTATCAAGCTCGGAGACA
TGCGGCAGTCCGCATTGTGCGACGCATACTCTCAAGGTGCGTACGCTGTCTGATTGTGCTGGAATGCGTCACCTCAAAGTTACATCTTGCTATGGTGTAA
TAACTGAGGTTTATTTTGTTTTATTGTGTATATCGCTTCCGTGCAGTTTTCGAAGAACAGGAGGACCCTGAAGCTCGAAGCTTCTTCTCAGAAATCATTG
CGTCCATCTCGGATATCAAGTTCTCACCTGACGGTCGCTACATCATTGCTCGCGACTTCCTCACACTGAAAGTATGGGACATCAACATGAACTCGCGTCC
AGTTCAGACGATCAATGTAAGGAGCTTTGTGTGTGTTGGGAGACGTTTAAACTGTTAACGTGTTGTGCTTTCCTCTGCACTTTTACAATGTTGCAGATCC
ACGAGCACCTTCGCCCACGGCTGGGGGATCTCTACGAAAGTGATTGCATTTTCGACAAATTCGAATGCGCAGTCAGCGGGGACGGCAACAACTTCATCAC
GGGCTCGTACAACAGCGAGTTCCATATTTATGACCGCTATGGACGCGCCGACATCTCTATCACACCACGAACCGCGCGTGTGAGCCGTCGTCATTCCATG
CCACAGCGCGGCCTTGCGCAGCAAATAGCTGCGTTACCCACTCCTGGAGACCCGGACGCGTTGGATTTCTCGAAGAAAATCATGCAGACGAGCTGGCATC
CGTCACTGAACGAAGTGGCTGTGTCTATCCGCAACAGCCTTTTCGTATATGGTGCCTAGGCGAATGGACGTAGTGCTGGACGCGCCGTTAAGGTAACAAC
TAAGGTTGGCACGAGGAGAGTCCAATAGCGAACAGGGGGTTCAATCCAAAGAAACAGCGAACACGAAGCAACTGAAGTACAGGCTCTATTGAATTGTTTC
AAGCCAGAACGAATTGAGGCTGTTTGTTTCTGGCGCTGGTTGACCGCTGTGGAAGTATATCAAGGGAAGTATCACGAACTACATCAAAACAATATAATCG
GCGCTTCTTGATTGAGGTCATTGCTATCCGCCTTACACCTTTGTCGTCAAAACTTCCCTCCGACACAATCCATTGCAAGGCATGACGATATACATGTACA
TGTACTAAAGCTCAGCAATGCCGAAGAAACGGTGAGATAATAACACTGTAACCAGCGAAAATCTTTTGTTGCAGTCACAAAATTGCAGCTGAAAGAAAAT
CGTTACGACTTCAACTTGCCGGATCGTAGTTCTGCCCGTATAGGACGATAAAAACACTTTAAAAAATAATGAATGCAGCCCTTGCGCTGCTACCAAACAA
TTCTTCGTGATCGTATCGATACACGATCGATGGTATCGATTTGTATCCCCAACTCGCGCACCGAAAACGACGCGCGACCTCTACTTGGAAGTCAAAACAA
CTTCAACGTGTGACGAAAGTATCTTCTACCTGGTAGTCATGGCTAGTCAACGGTGGTGTCGTTTAAGGAGATCTTCGAAGCCTTTGATGGCTGAGCAGCA
GATAACACCACCAGGATGGCAGGGCGAGTGGCCTCCTCCGTATAACGGGATAGAGGAGGTGGCTGGGATGGCGTACGAGGGCCTGCCTCCAGGCTATGGG
AGCGGCACATCCGACGGCGATAGTTCTGACACTAACTCGCCACCAGTGGATTTGTACCAAATGATGCTGGATGCTGAAGCTCAGATAGCCTTCGGCCCTA
AACCGGTGGCGTACCGACCCAAGGCTGAAGATCAAAGCTCCTTTACCGCTAATCAAGTTCCTTACCGCCCCAAGGGCGAGAGCTCCGTTCGTCATGCCTC
GCCAGTCGCCCCTGCAAGGGAACCAGCGCCCATGAATGCGTCAGACTGGCAGCCCACCTTCTTTACTGGCGATACGGGACGCAGTTCTACCGAAGGTTTG
TCCAGTAAACTACCTCCACAGATTCCTATCGCACGACGATCTCACGTTCCTCTTCCCTGGACAGCGGAGATGATTTCGTCGGTCGCATTTGATCCAACAG
GGAGACATCTTGCAGTTGGGAACAAAGGTGGCCGTATCGCCATTTATTCCCGACGAGAAGCGCTTTCCTCGGTCTGTCTACCCATTGCAACGGGTAAACA
CGTGCTGATTTGCTAATGTTGCAGCGTAAATTTGATGCGCAGAACCAGATTCCACACGCTTCAACGTATGCTCCTTTTGCCGAGTTCCAAAGCCACAGTG
CGGAGTTCGACTACCTCAAAAGCGTCGAAGTCGAGGAAAAGATTAACCAGATCAAGTGGTGCCAACCTTCCAATGGGTCCCAGTGTCTGCTGTCCACAAA
CGACAAGACTATTAAGCTCTGGAAGATACACGAGCATGCTGTCTGTCAAATTACGACGTACAACGAACAGGGGCTCGCTCATGTACCACACGAACGAATC
ACACCGGAGCAAATTCGCTTGCCTCAAGCCGAAATTCGCAGCAAGACGATGACTTCCACGATTAAAAGGGTTTACGCCAACGCGCACACGTACCACATCA
ACTCAATCGCCATCAACAGCGATGGGGAGACGTTCATGTCGGCAGACGATCTCCGGGTCAACTTGTGGAGTCTTGGCGTCTCGAATCAAAGTTTCAGTGC
GTGTTTGGCACGGGACGTGCGGTTGATGATAACAGCACTAACTAATGATTTGTCAATAATGGTTTGCAGATATCGTGGACATCAAGCCAGCCAACATGGA
AGAACTTACTGAGGTCATCACAGCCGCGGATTTCCACCCGACACATTGCAACACGATGATGTATAGCACCAGTCGCGGTGCTATCAAGCTCGGAGACATG
CGGCAGTCCGCATTGTGCGACGCATACTCTCAAGGTGCGTACGCTGTCTGATTGTGCTGGAATGCGTCACCTCAAAGTTACATCTTGCTATGGTGTAATA
ACTGAGGTTTATTTTGTTTTATTGTGTATATCGCTTCCGTGCAGTTTTCGAAGAACAGGAGGACCCTGAAGCTCGAAGCTTCTTCTCAGAAATCATTGCG
TCCATCTCGGATATCAAGTTCTCACCTGACGGTCGCTACATCATTGCTCGCGACTTCCTCACACTGAAAGTATGGGACATCAACATGAACTCGCGTCCAG
TTCAGACGATCAATGTAAGGAGCTTTGTGTGTGTTGGGAGACGTTTAAACTGTTAACGTGTTGTGCTTTCCTCTGCACTTTTACAATGTTGCAGATCCAC
GAGCACCTTCGCCCACGGCTGGGGGATCTCTACGAAAGTGATTGCATTTTCGACAAATTCGAATGCGCAGTCAGCGGGGACGGCAACAACTTCATCACGG
GCTCGTACAACAGCGAGTTCCATATTTATGACCGCTATGGACGCGCCGACATCTCTATCACACCACGAACCGCGCGTGTGAGCCGTCGTCATTCCATGCC
ACAGCGCGGCCTTGCGCAGCAAATAGCTGCGTTGCCCACTCCTGGAGACCCGGACGCGTTGGATTTCTCGAAGAAAATCATGCAGACGAGCTGGCATCCG
TCACTGAACGAAGTGGCCGTCTCTGTCCGCAACAGCCTCTTCGTATATGCCGCGTAA