Transcript Name :
Phypl_g5833
Orientation:
(-)
Number of Exons:
6
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.1210.075175
InsideOutsideTMhelix
1-156
157-179
180-512
NN-scoreoddsWeighted Score
0.7082.4350.005
PositionContextScore
121RRLRGRR|GF0.522
136TRSFRYR|SS0.502
TypeScore
mitochondrial30.4
GO
*** None ***
*** None ***
*** None ***
Sequence
        3390 bases(100 bases per row)
TGGCTTCGTCCCCCAGGGACCACGAGGTGATCGACGTGGGCACTGGCCCTGCGCTGTTTGAAGGCCGAGGACGACGCACACTGACGCTGGACGGAACAGA
CGCACAGGGCCGCTATGACGACGGCAATGAAGCGCTTGAGACGTCCAGAAGTGAAGAGGAAGAGGAGGAAGACGACACGCAGTCCACAGAGGGCGAGGAA
CACGCGTACCGACGTGGACGCCAAGCTATTCCCATGGACTCCCCAGGTGACGATCTACGTGGAGACCATTTGATGCTGGATGGGGACGAGGAGGACGGAG
ATTTGGCCAGACGCATGGCTGGAATTGGTGTTCAGAGACTGCGGCGTTTAAGGGGGCGAAGAGGCTTCTTCCATTCGGACGCAGACACTCGCAGCTTCCG
ATACAGATCTAGTGGAGGGATCCTGCAGAGAATTACGCTGAGAAAACGCAAAAGAGAAGACCATGATGTGTTCTGGACGGCTATTGGAGTACTGACGCTG
CTGAGCTTCGCACTCATGAGTAGCATTACGATCTACTTAACGCAGACGGACTTCTTCGAGTCACATCAGAACGATCTTTTTGGGACGACAGTGGATAATA
GGTTCACGGTGGTAGCGGAGGACGACGCACAGATATTCTTGAAGAGCGGTAAGGAGGCGTAATGGGGTAGTTGTTTTGAGTCACAAATTAATTTTTTGTA
TGGCGATGCCTACGTGTAGGATACTCCAATTCCGCTTATTCGGAGGGAATGATCGCTTTCGATGATGGAGAACTGAAAATTGGACGACGGGCATTGGATT
CCGGAGACCAGCAGACGTTTTATGGAGTGACTTTCTTCTCCAATGGCACGGTGACGTTCACGAACAGGGTGGATTGTAAGTATACATGGAATTTGCTGAT
GTATTTGTTGTTTTACTAATCATTTTGATGTTTTTCTGTGGATATTGCAACAGCTCCCATGGTTGAGGCAGATTATCTGAGTGCCAGGAAGGGGGTCGTT
TTTGACGATGGCACGGTGATGACCACAGCTGCGAATAGTTCAGGTGGCGTGAAGGAGCAGGGTGACTTGAATCTCGTGTCAAAAGCAGGAGCTGTTATTA
CGAGCGCTGGCGGAAACTCGCTGCTATTCGTCGACCCTGTTGGGACGGTGACAGTGGCCAACACAAATGCGGACGATCCTACAGCAGCTGGTATTACGCT
TGATGGCACGCGTGGACTGATCAGCATCGGAAAGGGAGTGACGCTGAAGTACGATGGTAATGCGACGAGTTTGTCGCCATCCCAGGATCTTTATCTCGAC
ACAAACAAAGTTTTCGTTGGTACTGCTACCGGCGGAAAAGTGCGGGTTTCTGTGCCTGGTGGTGACAGTAATGGAGACGATGGCGCGCGGGCGCTAGCGT
CAGGGGAAGAAAGCGAGAGTGTGACACTGGAAGTGGCTGGGCAAACGTCTTCGACGCAGAAAGAAGGTGGAGACATCCGCATTGTGGGTGGTGACGGCCT
AACCGTTGGGGGTGATGTTACGTTGGTCGGAGGTCAAGCATCTGGGTCAGAATCAGAGTACGGATCAATCACCATTAACGCTGGCCTACAGAAGTCTGCC
TCTTCACAAACAGAAATTGGCAGCCACAGTCCAACCCATGAGGTTAACATCCACGGCCTTGTGTCGTTTAATCAGCACTCTGGTGGTGTCAATGATACTA
CGCAGGTTAAAGTGGGAGGTGGCCGATTCAACGTGTCAGCGCAACGGATTACTCTTGATAACCGAGACATAAGCTTATCAGAGCTGCACATCAACTCCAA
TGATGTTCGCTTGGGTGCGTCTTCTCCGTCAGTTCAAGTGGGGAAAGCCAGCTTATCGACTGTCAACGTGCAAGGTACTTCAATTTCACTTGATGCTACG
AAAAGTGTTGCAATTGGCGGAAGCTCTTCTTCGATTGTTGTTGGTGACTCCAAGACTTCAGGACAGGTGACCAAAGTCTCATCCTCTGGGATCGAGCTGG
AAGCGGCGCACTCAGTGTCGATAAATACGCTCAACCGTAAAGCTGTCACCACCGTTTCGGGTCTGGTGCACTTCAACGGCAGCTCTACTACAACCTCCTT
GTTGTCTATCACGGACGTTGCTGTGAGAGTGAATCCTACGAGATTTCGCGTCGGCGCTAAAGGAAAAACCAGCATTGCGACTATCGAGGCGAACCATGTG
AGCATTGGTGGACCGGGAGCAAACGCGACAGCACTCCCTACTACAAGTAAACTCGAGCTTTTCAGCTCCAATATCGCTATCGGATCTAAAGGTTGGTTTT
GTGGCTTTGATGTGATTGGAGACGTTGTTCACTCATACATTGTCGTGTATTTTTTGTCCTTAGCGTCTGAGGTTTCAGTGAAAGGAAAATCAGTGACTGT
GGATGCACTGGAGGCCCTAACGCTTGGAGAACAAGCGGACGAGATCACAGTTGGCAGTGAGAACGTGGACAAAATCAATGTTCAAGGCGCTGCAGTGTCG
TTGGCAGGTGCGTGACATTAGTCAAATCTTGGATGGCTGATAAATACTCATTTGTGTGTTTTGCTTTTCAGGGACAACTTCTATCAGTGGCGAGTCGCTC
GCTGTGACCTCAACCAAAATTGATATTGGCGACAAGTCGACTAGTGAAATCAGCATCGGAGCATCCGAAGCGACTGTGAACATTGGCTCGGACACCAGCG
TGGTCAACCTCTCTGGCAGTGTCACGATCAATGGGAAGGCGTTAGATAGCCGCCGTTTAGCTGGGCAGACCGATGTGTTGGGCGACTTCAACAGTAAACG
TTTTGGCTATCTCAATGCTGATCACCTTACTGTAGCAGTCACTCAGCCCGGGCCCAGTACAACGTTCGCACTTCGCTGGGACAACGGATTTTCTTCCGAG
CCTCGGGCGTTCCAAGTTAATATCGCCACAGAGCGGCTACTTTCAATTGCGAACAGCAGCGAGGTGGACACAAGGCATCTGCGATTGTCGCTCCAGATTT
CTAGCATTGTACTCGCTGTTGCAGTTGCAGAACCAACAGCCCGACCAAGCAAGATTCGGTATGTTTATCTCTTCTTCCTGTTTTTTTTTCGGGTTGTTAG
TTTGACGTCAATCGCTCAATGATCTGTTGATAGGTGTCGCGTCTATCGCCACGCTACAGGACAATTGGACGCTGTGGCTTTGGAAGTGAGTGCTCTAGTC
GAGCACTGCGCCGGTGCAGCATGCCAGGATGGGATCTTCTTGGGGCTTCAAGGCCAGATAATCGTTCCTGTCAGTCCTGGCGACTCGTTCTCCACCCAGT
GTACTCTTATTTCAACAACAGCAGGAGAGCTGTTACTCCAAGGTGCTCAGTACTCGTTTGCAGAGCAGTAGCATCATGAATTACCCCTAA