Transcript Name :
Albla_Nc14000500
Orientation:
(+)
Number of Exons:
1
Description :
polycomblike protein putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
CXC domain15.964PS51633
SET domain15.458PS50280
HmmSmart predictionP-Valprediction_id
SET domain4.2SM00317
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
CXC domainIPR026489
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        2967 bases(100 bases per row)
ATGAAGCCAAACAGCACCGATAATACCTTCCACTCCCTTCCAACGCGTCTGCATTCTTCTCCACATACAATTCCCCATAAAATCCCATTCTCTAAATCCA
TCTCCACCCGAATCGAACGAAATGACAGCGCAACTACCTCCCCTCGACATTTATATCCATCCACCAATGCTCCCCCATCCAGCAAACGTCGTCACGATCG
AGCTTCTCGACATAAGAATGCTTTCACTCTGTCCACCAAAACATGTACCAGCAGTCGAAAGCGCATATGTGACACCAATCCATCCGACCTGCCCGTACCA
ATTAGAAAGCGATCCGTCAAACTCCGAGAATCACTCATTGAGGCCTTACCAATCTCCTCGTACTCGATCCATTGCACACATTGGCGAAGATTGCATTTCC
ATCAACCACCTGAAAATATCTCAAGCCCAAAGGAGAAATTATTTGTGCCTTATGACAGCTCAATGGATGGTCCATTGGCTGAATTCGATACCAGCAATTC
CATCGGCTCTGAATGTGAGATTCTCACATGTCTAAGACATCCAGTCTTCCCCTTCCAGGAATCAATGCGAGAGCGTATCGACCTACAGACTCAAGTGCTT
GAAGCGAATGAGAAGATCTCACGAGCGATGGAGGAGTGTTATCGCGCTCGAGTTTCGTTCATTCTTAGAAGCACACGCGAATTAGTAAAATTGCAATTGG
AAAAAGTGCGAGAAAATCGCATCGGAATACAATGTTTGGTGAGGGAGTCAAAAAAAGAATTTTATCTGAATATCTCTGAGAAACGGATCGTATTGGCACA
AAAAAAATGTATACAAAGTACAAATGAGAATCCTCCAAAATACTGGCAAGTGTGGGAAGATCAGACGTCCAGTCGATATATTGAGAAAGAGCTTTATCCA
CGTCGAATTTTATACTTTGGGGAGCTTCCTGTGCTTCCCAATATGGGCGCATGTGTTGGGTCTGGGGAGCTGTATCCAGTTCAAGATGATCCAATTATAC
GGTATCCGTTATCCTCTACAGTGGAATCAGATCAGATGGAGAGTGAGGGGATTCAAACACTGTTAAGAAATGAGTGTGGTAGTGCGTTGGATGATGAGCG
GAGTGAGTACTGTCTTCGGTACTTAGTGGCAAAATTTCGTAAAATTCCGAACTTTATGCGTTTACTGAAAAAATACAAGCTTTTCACACAACCCGAGACC
GATTATTGCGATTTACAACGACGACAACAAGCAACAAACGCGAAAAGTCTTTTATCCCGTTTTGAGGATTTGAGTCTTCGAGGACGGTTACAACCTTACT
GGTACCCCTACACCACTCATACTCAACTTGAGAGTGAGGAAACCAGTCATCTTGCGCGTTTATTCTGTCGACAATGTTACTCATATCATTGTGTATTACA
TGGAGGGAGTATGGGCGTCCCTCATCGTCGACAAGATCCAGAGTACCCTGCTATGGTTGGGTACATGGAGATTGAGGAGGTTGAGGAGGTTGAGGAGGTT
GAGGAGGTTGAGGAGGTTGAGGAGGTTGAGGAGGTTGAGGAGTCTGAGGGGGTTGAGGAGGTTGAGGAGGTTGAGGAGTCTGAGGAGCCTGAGGGGGTTG
AAACAGAGGTTGAAACAGAGTCTAAATTAGAAGCTCTGATTATCATTGAAACATCAGATCAGAATCTGCGTCGATCGAATCGAACGTCCACCGCAGTAAG
CACCAAAGCGTCTTCTTTTTTGCATGGAATGTCTCGAGTTTTCATTGAGGAAACCAAACGGAGTGAACCTCTAAAAATTCAAACCAAACGGAGTATACCT
CTAAAAAATCAAACCAAACGTAGTATACCTCTAAAAAATCAAACCAAACGGAGTATACCTCTAAAAAATGAAACCAAACGGAGTGTACCTCTAACAATTC
ACCATTGTGAGCAGATGGATGAGAGTGATTATGGAGGTACGTTACAGTCAATGGAATTTGCACAGCAAAAAATTCAAAGTGTTATTCACAAATGGACATC
GATACAGTCCACATTAAAGGATACTTTTTTGGAAAATGGAGCGAGTATCAGCTCTGATAAGCTGACTGCGTGTACTGGGCCTCAGGAAGCGCAATTAGAG
CGATGGATGGCCAAGATATCGAGTCGACAAGCATTTCGATCGGTGAACTTAAGTGTGCAAAATTTTGATGTGGAACGTGTTCATCCACACCATTTACATC
AAACTAGGATTCAGCGAGTTCGGGATCGTGCAGCCTCACGGGAATGCAAACCGTGTCGGCATACACAAGCGTGTGACTCGAATGCGTGCAGTTGTATTCA
ACGCGATCACTTTTGTGAGAAAGCTTGTCAATGTCCAAAAGATTGTCCGAATCGATTTCCAGGATGTGAGTGTGTGTTTGGTACTTGTGGCACTATATCG
TGTCCTTGTTTTGCGGCGAATCGAGAGTGCGATCCAGATAAATGTATGACGTGTGGGGTGGTCAATATTGCAATTGAATGGAATTGTATGACAGATACCG
AGGTTTTATGTGGCAATGCAAACATTCTGACTGGAAAATGTGCACGTTTGCGTGTGGCTGTGTCTGAGACGCACGGGTACGGTGCGTTTGCGGCTACAAA
ACTTTCAAAGCGAACGTTTATTTGTGAGTACACTGGCGCATTGTTATCTCAAGACGAAGCGGAACGTCGAGGGAATGTTTACGATTCCTCGAAGTTGAGT
TACTTATTCGATTTGAATGAGGATCGTGTAATTGACGCGACTCAAATCGGAAATAAGAGTAAATTTGTAAATCACTCATCCACGCGACCCAATGTGGAGG
CTATCATTATGAATGTGAGTGGACAACATCGTATTGGATTTTATGCGAAAGAAGTTATACTCCCAGGTGAAGAGTTGCTCTTTGACTATGGATTTCGGGA
CGTTGTACCAGAGTGGACTCAGTTGCCACAACTGATGAGTCCTGGCGAAAGGTCGAAAAGAGTATAA