Transcript Name :
Phypl_g411
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_262124
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Myb domain12.992PS51294
Myb domain12.992PS51294
HmmSmart predictionP-Valprediction_id
SANT/Myb domain0.0000000019SM00717
SANT/Myb domain0.0000000019SM00717
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Myb domainIPR017930
Y-scoreD-scoreY-pos
0.0840.12719
InsideOutsideTMhelix
1-202
*** None ***
PositionContextScore
77KINRRRR|GL0.698
*** None ***
GO
Biological ProcessGO IDPrediction Method
chromatin bindingGO:0003682IEA
*** None ***
*** None ***
Sequence
        608 bases(100 bases per row)
ATGATGATGCCTAACAGCACCCACGGAGGCCTCGTCGTCTCTCCAGCGCCCTCGACGCCGATCACGCGCGGACTCTGGTCTGAGCAGGAGCACGAGCAGT
TCCTGCACGCCATGAAGATGTTCCCGACGGGCCCGTGGCGCTCCATTGCCGCTTTCATCGGCACGCGTTCTATCAAGCAGGTACAGACGCACGCGCAGAA
GTACCAGCAGAAGATCAACCGCCGACGACGTGGTCTGCGCAAACAGAAGAAGAAATTCGTTCGCCCCGAGCACCGCGTAGACGCCCATGCCACCGGTTGC
ATCCAGCGCGTGAAGAACTATACAGTGCAGGGATCGCCGCGATCTCCGTCGGCTTTTCCCCTCAGCGCCATGTCCCCAATGAGCGGTGGCTTCGGACAGC
TACTGACGGGCGGTTGCAGCCCTGTAGCAAGCGATGCCGGCAGCAGTACCAGCAGCTTTTCCGGTTTAGACTTGGATGTCGACATGGATTCGCTGCTGTG
CGAGCTGGAACCGCTGCCGTACACGCCCGGAGTGTCGTTCGAAGACGTCCTGGTCGATGACGCTTACCGACGAGACGTGCAAGAATCTGTCGACCTGCTT
CTTGCCTA