Transcript Name :
Phypl_g959
Orientation:
(+)
Number of Exons:
5
Description :
conserved hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0720.09131
InsideOutsideTMhelix
1-362
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1364 bases(100 bases per row)
ATGGCGCTGCGTCTGCGCCAACTGCAGGTGGTGCACCGCCATGGAGACCGCACCCCGTTGATCAACATCTTTAAAGGGGCTGTCAATGCACGTTACGAGG
AGGAGGAGGCGCTACTGTGGGGGGGACATCTTCCAGCGCCGACGCAACTTGCGCAACTCCGCTCCAAGTTCAGTGTGCACATGGGCGGCGAACCCCAGAG
CTCCTTCCAGCAGCGCCCGTTTGGGTACTTGACGACTCGAGGCATTGCACAGATGACCGAGCGTGGTGATCTACTTGTAAGATACAAATTAATCTCTGGA
AGCAACGATGGAAGTGAACTGATGGACTTGTTTGTCGGCGACAGCGAGAGTTCTGTGAGAGGGAGGAACTGCAGCTAGATGAAGTGACTCCGGAACAGGT
GCAGATCTTCAGCAATGCGTACACGCGCACACAACTTAGTGTGCAAGCGCTGCTGGATGGTATGCTACGCGACCAACCCCAGTTGAGCCCTCCAGTGAGC
GTGCTTCCGCCGGAAAAGGATATCATCAACAGTGCGTTTTTGCGTGGTTCTTCCGCAAATTTAATAGTGAGCTGATGCTGTCTGTACATGTGTGCAGCTT
ATCCGCTCTTCCCGGAAATCATGCAGATGAAGGCAGAATTGGAAAGAGACAACGCGGAGTTCGCAGCGCGAGAGCACGACATGATTCCGGTCAAAGAGGA
GTTGAGCAAGCTGTTTCCGGCTGTAGCCTCGGGACAGATCCCTTTCACCTGGTTAACTGCTGCCGACTACTTCGTCTGCCGTCGTGCCCATCAGGCCCCG
TACATTCCTGGCACAGAAGTGCACGGTGATGTCACGGAAAAACACCTCGGCTTTCGTTTCCACCAGGTAAAAAGAATATCTGCTGGGAATCATCTTGGTA
TCATAGTGGTAGGAACTGACAAAGCGTTGTGGTTCCTGCAGTTTTACTCGCACCGGACGATCTTGAAACTTGTGGCCGGACGCTTGATGCACAACGTGCT
ACGTGAGGTGGGTCAATTTCGCGCTATTGCTGCACTTTGAGTAGATGGCTGAAGTCTTATGCATTACATTGCAGATGCAAAAAGCTCTCTGGGACCACAG
CGAAAGGAAGAAGATCGTGATTTACAGTGGGCACGACGTGTCGCTGCTGTCTGTTCTCCGTACCATGGACGCTGCAATTGCAAATGACATCAGCTTTTGG
CCCGAGTATTCGTCTGCCATCGCACTGGAACTACTAGAAGACGAGGACGGGAAATTCTTCGTTCGTGTTCGACTAAACGGCGAAATTCTCGCTATAGGCG
AAAGCACAGACGGCCTCTGCTCTCCTGATCGCTTCCGTGATATGGTGTCGGACCATACGGGTTA