Transcript Name :
Phypl_g969
Orientation:
(-)
Number of Exons:
3
Description :
hypothetical protein PHYSODRAFT_445056
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0450.04634
InsideOutsideTMhelix
1-166
NN-scoreoddsWeighted Score
0.6495.3810.011
*** None ***
TypeScore
cytoplasmic60.9
GO
*** None ***
*** None ***
*** None ***
Sequence
        1188 bases(100 bases per row)
TGAACGCGGAGGAGATGCGCGAGGAGCTCAAGCTCGTGCGCCACACGCGGCGCTGCAACGGGCGCGATGTCTGCTCGTGTATGCTGCGTGTGGAGAGCGC
GTACTTCCAGAAGAACCTGGCTGGCAAAGCCGCCGCTAAAAAGCGCCGAGTGGACGTTCCTGCTGCGGCGAAGAACAAGGCTTACAAGTACGAGCGCGTG
ACCAACATTCAGCAGCTCAACTACGAGGTCAAGCTTTATATAGCAGCTTTCCTGGAGCCTCCTGCGCTCGGCAGACTTGGAATGGTGCGTCCATTTGCGA
AGATATTGACGGTTGAATTGCTGACGTGCTGTGGCCTGTTGACAGACCAATAAAGCGTTCAAGGGCGATGTGGATATCATGGCCAAGCAGGCCATTGGAC
AGTTCCTGGCCGAAGTGCAACCGGAAAAACTGCTCAAACAGGAGAAGCCAAAGGAGAACGAGTCGTGGTCGCGGCTGCTGCACAATCAGTTTACGTGTGT
GCACAAGCTCTTCGTCTACTACACAGGCTATAAGACTGGTCCAATGAGGCAGCAATTCGCACACTGGGCGTTCGGTGTCGTGTGCGTGGATCCGAATGAG
CCGCACCGAATTATACTGCCAAATACATGGACGTTCCACGGACACAACCCATGGCAGCGACTAAGAGGCAACGGAAAAGGAGGCGAGTGGCAGCTCACGA
AAAAGTACGCTGAGAATAAAGCGCCTACAGATTTCTTGGAGAATGTCAAAACGTGGGCGAACTCGTTAAAGCCCGGATCCATGCTAACGATCGCAGTAAG
TTGCTTATTACTGTTCACTGTTTTTGGATTCATGCTAATACGTCCTATTGGTGCAATACGAATAGTATCAGAACGCTGGCTCAACGCAGCCGGCGTGGTG
GGAGGCACAAGTTTGGTATGTCTGGCGTGGAGACGGCAAGCAGTGTAAGCGCATCTACTCACTGCAAAACAATGTGGTACTTAGTACTAACGTGTACATG
TACTCTTGCAGATCCTGCACTCGTGTACGATCCTGAAACTGAAACACGCATAGAAGTCCATCCAGATGGCTTGGAAGAGCACTTTAGGGTGAGTTCTATT
GTGCATCGATCTGAAGTGAAGTTGGGACGCGACTGACAAGCTAACACTTCCTGTGTTTTGGGCAGACACACCCGTTGCACGTTATTGA