Transcript Name :
Phypl_g962
Orientation:
(-)
Number of Exons:
2
Description :
hypothetical protein PHYSODRAFT_477864
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Legume-like lectin25.693PS51328
Legume-like lectin25.693PS51328
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.7860.84926
InsideOutsideTMhelix
1-385
386-403
404-415
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
membraneGO:0016020IEA
*** None ***
*** None ***
Sequence
        1324 bases(100 bases per row)
TGAGCGTATCTCGCGTGCTGCTGGTGTGCGTGGCAGCGCTGCTGGCCTTGCTGCAGTCTTCTCCTGCCATTGCGAAGCGCCTGGACCACGTCTCCTTCGA
CAAACCTTTCGACAACATTGACGGTGAAGGACTACGCCAGATCGGAGACAATTATATCTATGGCGGCGACACGGCCGTGAACCGCCACTTCGCTCGTCTG
ACACCCGACCGCCAGAGCAAGCGCGGCCATATCTGGGGAAAGCAAAAACTGGCAGCTAAGGAGTTCGCTGCCGTGTTCACATTCCGTATCAGCGGTCAGG
CCAAGGCCTGGTTCGGCGACGGCCTGGCGCTCTGGCTCACGACTAGTCAGTATGTGCAGGGTGACAACCACGGCTTTATCGGTGAATTTAAGGGCATCGG
CGTCGTGTTCGACACGTTCATCAACCAGGAGCACAGCGGCGGCCACAAGGATGTGACGTTCTTCGAAAACGATGGCACTAAGACGCTTGACCAGCTCAAT
GACATGGAGAAGGTGGGCTGCATGGCCCCCGGCATTCGATACCACGAGAAGAACGCAGCCTTCAGTCCATCGCTCAACATGTCGCGTGCTAAGGTCACGT
ACACGCAGGCGGACCAGCAGTTTACGATCCTGATCGACGCCGACGCCTCGGGCAATTGGGCCAAGTGTTACAGCCAACGTCTGAGCATCGGCGATGACTG
GCTGAACGACGCGTACATCGGTATTTCGGCCTCGACGGGTGGTCTGGCCGACAACCACGATGTCATCGCTTTCAACGTCTACGAGTAAGTCTTCCTAGGT
TACAGGTTCTGGCTTTTGTGGAGGTGGCGAGACTATTTACTTACTTTATGGTGTCTTGTAGTGACGTGATTGATTCGCTCGCAGCCCAAGAAGACGAGAA
GCAACGCAATGCGGTGGACAAGAACCTCGAAGCTACACTCAGCAAGGGAAGCAACGATGACAAGATGAAGTTGGTCAAGCGGAAGTACGCTCAGCTGCTT
GAGGACTTCGAGTACCAGTTCACTGCTCTGAAGGAGTCTACGGAGAACACGATCCAGAAGCTGAAGCAACAGGGTACTGAGGATGAAAAACGTATTGATG
AGCTGGAGGCTTGGGCAAACGGAAAGGTGGTTGAGCGTGTGCACAGCACAGTGAATGCTATCCGCGATCAGGTGGACACACAGCTCGAAGAAACCGTGAA
AGAAACGGCCGCCAAGTCCAGTAGCTGGAAGACTCCGTTCTTCATTATCGTGTTCATCATTGCCGGTGTCGTCGCTGCCGGGTACAAGAAGTACCAGGAT
CTTCGCAAGACGCACTTCCTGTAG