Transcript Name :
Phypl_g10649
Orientation:
(+)
Number of Exons:
3
Description :
conserved hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0770.06529
InsideOutsideTMhelix
1-478
*** None ***
PositionContextScore
117RLKRKAR|SL0.719
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1629 bases(100 bases per row)
ATGGTGGACAAGACTTCGCCGACTTCGACTGCGCGTCCGCTGGGTACGACGCCGTCCCTGGGCGCCGCTAGAACTGCTCGTGCTTCTAAACCTAAAACGG
AGTCCAATGCGAAGCCATCGCTGGTGTTTTTGCGGCTGAAACGCAAGCGTACGGACGACCCGATGGAGTGTTTAGTGGTGCACAGTGAACCGGATTCGAA
GCGCTCCAAGGCATCTACAGACCTGCTACAAGCCTTTACAAAGCTGTCGACCACTGAAAAGCGCTTTGTGTTTAAGCATATCGACACAATGGAGGAGCCT
ATCGCCCCAGGACGCGTCAAGTGGACCGAGAGGCTCAAACGCAAAGCTCGTTCTCTTAAAGACGAGCGTGCCGACATGTTGGCCAAGAAACAGATCGCCC
CAGTGTTCCAGAAGGACCCTACAGCCTCTAAACAGACGGGAAAATGGGTCCAACAGCAACATAGTCGCTCTAAAGCGCGACGGAAAGAAGAAATGCTCAA
GTCCAGAGGTCTGCAGCCGATTGTGGAGATTAAGGAGAAGCAGACGATGGAGCTGCACGGCATTCGACTGGTAGATTTGCAGGTGTCAACAGCCCCAAGT
ACGGAACAAACGAAGAACGAGAAGGAGGAGGAGATTCTGGAGAAAAACAAGGCGGATGTCGTCACTGTCAATGGAGCCAGACTGAAACCCACGAGAGTGC
TGAACCCGCACGAGCGCGAGCTGGACGAGGCCATTTGGACGGCTTTTCGCGCCAACGACTTTGCTCCTTTCTTCCAGATTTACCATGCGCGGCGGCCAGA
GCTTCGTGCGGACCCAACGACGTTTCAACGACCAGCAGATGGAAGTACCGTCCTCATGGCGGCGGCACTGCACGGACGCAGTGATGTTATCGAGGTGCTA
TTACGCGCTGGTATTACGAGTGTGCTCCAAGAAGATTGGGAAGGAGCTACTGCTGCGATGTTTGCGAAGCGTGGCGGACACGCTAATGTGGAGACTGCGC
TACTTGCGTGTGAGGAAGCAGAGCATGAAAAGGATTACGTCTACGATGTGTACTGCGTCGATATCTCGGCAAGTGAAGGACAAGACACCGCTGATGGCAC
CGCTCCCCACGCTGAAGGTAATTCGGAAGCAAAAACAAGTGTAAACGGTGTGCCGGTTGTCAGTGTGAGCTCGGAGGTGCACCGATGGCTTTCGGAAGAC
GCAGTGAGCGATGAGGTGGAAGAATACATGCTGGAGTCGGACATCGATAGCAACGATGAAGTTGACGGGTACGCTTGCCTGTATAGATATCCGTGGGACC
GCTGAGGCGTGAGCGGGACCGATCTAAAGATCATAATTCTGCGTTGTTTTGACGCTTTCTGTTGCTTGTGGCTTGCCTGCTCTGTAGATTGAGCGAGGAC
TCCAATGACGAAGACAATGCCGCGAACGACTACCCTGACGAAGAGTCATCGGACGAGTCTCTGGCGGACAGCGACGACCTTGACGAGGTACGTGGTAGAG
CTTTACTGTAGTATTTTCGGATGGGATTTTGATGGCATTTCCGTGTCTTTACGTTCGGCAGATTGGGGCGAGACGTCGTTGGCAAAGTTCCGAGAACGAC
TACACTGAGCGAGACGACTTCGACTATTA