Transcript Name :
Phypl_g747
Orientation:
(-)
Number of Exons:
11
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Bromodomain0.000000058PR00503
Bromodomain0.000000058PR00503
Bromodomain0.000000058PR00503
Bromodomain0.000000058PR00503
Bromodomain0.000000058PR00503
Bromodomain0.000000058PR00503
Profile scan predictionP-Valprediction_id
Phox homologous domain12.669PS50195
Phox homologous domain12.669PS50195
Bromodomain15.907PS50014
Bromodomain15.907PS50014
Bromodomain14.872PS50014
Bromodomain14.872PS50014
HmmSmart predictionP-Valprediction_id
Phox homologous domain0.00025SM00312
Phox homologous domain0.00025SM00312
Bromodomain0.00000000000032SM00297
Bromodomain0.00000000000032SM00297
Bromodomain0.000000000025SM00297
Bromodomain0.000000000025SM00297
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0850.0834
InsideOutsideTMhelix
1-1198
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        10639 bases(100 bases per row)
TGGCGTCTCGGCCTCTGCCCCCAGGGCGCCTTGGCAACGACGCTCGCTCCCCTGTCCGGCCTAACGTGGCGCTGCGTTGGACCAGCAATGTCGCGGCAAC
ACCCCCTGCTCCTAAGGACGCGCTCTCCCCGGTAAAGCGATGGCCGCCGGTAAAAGCTCAAGTTCCGCTTCAACCTCCAGGGGTTGTGACATTAACATCG
AAGGCGGTACTCCAGCCTGCGGTGGAAGAAAACAGAGCAGTATCCGCCTTCCAGTCGGCGCGCGCCGTGTTTGAGGCCAAGAAGACTACTGCTGTGTCTC
CCCCACCACCTCCCCCTACCCGTCACCGTTTCGCATTCCCCATTGAGAAGCAGCACTCTACGACATCCGATTTGTCGGCCTCATCGTGCAGTACATTGGA
CTCCGAGAGCGATCGAAAGCTGGAAGAAAGCGTCGCAGTCAATTACGAACCGGAGCCCTCGTCCCCAGTTCACGCTGTGGTGAAAAAGATGGAAGTGGAG
TTAGCCGGAGCTACTCCTTCCGAGCGGATTGTAAGAACGGCTTCGCCTTTCCTAGTTAATTGCGTTATACCCTCACCGTCTAAAGTGGCTCAAGCACCTC
CTCCACGCGAAAATGCAGCGACCTTGTCTCCACCCCAGCAAATAGCTAATGGCGCGTCCAACCACAGCGAGATCGATCCATTTCGACTTCTTCTTCCCAT
CGAATCTGTCCCAAGGCTTCCCGACGACGTTATCTGCCTTTACGACAGGGCTGCAATTGAGATGGAGAAAAACATCAAGAAGGTGGTGCGTAAGCTGCTC
AAGAAAGACAGGGTGCGATTAGAGGAATTCAAGGTGAACTCACGGCTATTTGGGACCGATTTCTTGGACTCAAGTGCTTACTTGGATACGCTTATCAAGG
ACTTCGGATCTATTCGTGCGTTGCATCTGGTGCCTTGCTTGCTTAGCATCCAACCAAACTTGGTGAAAAGCAAAGCTCTACTCCTCACAGCCAAAAACTA
TTTGCTACGAAACAAAGATGAGATGAAACGTGAACTCCAGAGAGTACAGCTATTGAGCTCGAAGAAGATCGCCACCGTTAATGCAAATCCTGATAACGAG
GTGATACCCGCAACTGTTGCAGCCTGTGACGGGACCTCGACTGAAGCAGCTTCCATCGCTAGTACAAAAACGACTCTCTCGGCAAACGACGTGGTTTACC
CGACAAGTGGCCATGCTGTCAGTGATCTTGTACAGCTTGGCACTGCCTTCTCCAAAACTGCTTCTCCAGTTATTCAACCTCCTGCTCTTACGGTTGTACC
AGCATTGATGACTGAGCCTGTCCAACAAAAAGTCAATGAAGAAGTGGTGACAAAGGCCAATACGGTAGAACCGATGCCTGAATCTCAAGTGATGAAACAC
GCCGAAACCCCGCCACCGTTGCTAAACATTGCTGTTAGCACTCCCAGTAGAATTCCAACAACGGCCCCAATCGTGCAAAAAAATACTTCTACCCCAGTTC
CGACGAGATCCGCTGAATTGGAAACCCCCATCAAAACCGAAGAAGGTTGTAAACCTGCAGACCTATTCGGGGAGACTTTCAGGCCCATCTCTCAGAAGAA
ACAAAAATCACTGCAGGCTGGAATTCCTGCTGCATCAACCTCTCCGGCCTCCTCGGTGCACAGCTTCGACGAAGCAGAAAGCTTGTTCGGAGAGCGTTTG
TCCCCGTCATCACGCACCAGCACGACCCGTCGAAAGTCTGTGACGTGGGGAGATACCCAAACAATGGAGGTCCCTGACAAAGTTTCCGTGATCAAGACAG
TGAAGAAGCCTGCACCACTTCTCTTTGGTCTCGCAACCGCAGCCGCCTTTGAGTCGGACGAGGACGAGTCCGACCTTAGCGACTGATACCTCTGCGAAGA
ATCGTGAATTGGAAACCTGTGTTTCAGAGATAAAATGTAAACTGCAGCTGTATAAACGCGTGATGCCACTTTTTGTTGCTGAGTATATGAACGGCATGTG
AGTTAAAGAGGCTGGTGGCGGCTGCTTGCCGACCGAGCCATCCTCCTATTAGTGTCGAACGGTTGGTGAAACTTGCACACAGTATTTAGTCCCTTTGATT
TGAAGTTTGTATGGGACACAATTGTATTTTGGTCCAAAAAAACTATATCACTCAAATATCATTACAACTATATTTTTAAAACAAGTATTCTCAATTTTGG
ACTCATATTATCATTACTACTTTGTGAATTTGAAATAGTACTAAAATCAGTAGAAAATAATACTTTTGCTGGTAAACTGTTTCCTAGTGAAGATATCCCG
GTCGTGTGATCCCTGCATGCGCGTCTCCGCCTCGCAACCAAGCCCATGTGGCTCACGAAAATGTATATCGTCTTCGTACCAAGTTTCGGCGCCGTATTCG
CTGTGGTTGGTGCGCTAAGAGCTACAGCGAAAGCCGTATTCACTCGACCCAAACCTTATGTATTTGATGAACTGATATATTATAAAAAATAGCAGGTGTC
GAAAATTGAATCGGAAGCCTAGACGCTGAAGGAGCAAATCACTTCCTCCGACAACGCACGAATGTCTTCTTCGCCCCAGCTTCAGCCACGACAGCGACCG
AGCAGCGGCGCCAGCTTGCAAGGAGACTTCCGTGTGGAAGTAATGGGCAGTCAGGAGTCGCTGGATCTGGATTGCGGCAAGTTTTACACGGTAATGAGCT
GCTTTGTCTGTTGTAGCAACTGCGTTTCAGAAAATTAATGCTCGCCTGTAGGAATACATTTTGCGCTGCTCTTGGATTGAGCGCAACGGGACACCCGAGG
TTTGTGCTGAGCACGCTTTCTTTGCAATAGTGTTGATATACGACTTAATTGCATGACGATGTTACGCAGATCTGGGACGTTGTTCGCCGCTATCGCGAGT
TTTGTGCGATTGACATTCTGGTGAGGCCGATAGAGTCGTTCGGCGTATTGTCGTGGGTGTCTGGCAGCAGATTAACGTATGCAATGAATGTGTCTGATGA
AAGCTGCGTGAGAAGTACCCGTCGCGAGCACCACTGTTCCCCTTCCTGCCCAGCAAGAAGTACATCGGCTCATCACTGTCGGCCGACTTTGTTGACAAGC
GGCAGCGCGACCTCGGCTACTACATGATGTCCATTCTGCACAGCTGCCCTCTCGTACGCACTCTCATCTGGCTTACTACATGACTGCATTGCACAACTGA
CTGAATTCTCTCTGGCAGCTCGTGCAGGACGAGATTATCGACTCATTCCTGGACATCAAACGACACATTTTGGAGAGGGCAAGGGAGGAAATCTCGGAGC
GCTCGGCCTCTACACCTACGCACACGACAACCAGCAGCAATGGCGGCGTAAGCCCCATGCGGCTACAGCACTAAACATTGAATGGCAAGGTCAATCGCTT
TCAATCCGTCTGAAAATAGTCGCTAACATTCTCCGTTTCTCCAAAGAAGACGACGGGTTCAGTCACACATACATTTTGTCATATAAACGTTGAGTACCCG
CCTAATCCGATCATGACCATCACTCTGCGCGAAGATTTCGTGGCTGCACGCGCACACAGCGAGCTGGGACCGGCCTAAACGTGGCGCGACGGTGAGTAAG
TTCGGGGGCGTTCGTTACCTGACCAGACAGCGCAAGACCTCTCCACGCGTGAACACAGGCGCGTCCCGTGTCCACAGAGCTCGCACCAAAACTGAAGTGT
GCCCTCCGCTAGGGAGAAAACATCGCGAAGATGGCGCTCGCCGACATCATGTCGGTGGAGATGAGCGCAAAGTATATGGACTCAAGCAGCTCGTCCAGTC
TGTCGTCAGACTCGGATGAAGCGTTATCCTCTAGCTCGTCGGCTATCTCGTCCTCTTCCGACTCCGAGTCAGACTCGGACACTCCACGAGCTTCGTTAAA
AAAGAAAACAGGCCCAAGGGGGCGAACAGGCAAGAAAGTCGATGCTGCGCTCTCGGATTACGAAGACGACTCGGACTTGAATAGCGCCACGAGCGGGGGC
AGGAAGAAAAAGAAGAAAATGACGAAACCTGCAGCTCCAAGACGGTCTCCTACAAAGAACAACGGGAAGAAGAAAGTGGCAACGAAGGCACCAATAGCAG
CGCCGCCGAGTCTCCCCCCACCTCCCCCACCTCCATCACCACCTCCGGGGGCCCCAGATGGTTCGTCCAGTAACAGCTCGCTTAGTGACAGTTCAAGCTC
AGACTCGTCAGACATGTCGGACTCAGAGACGCCGTTGCCGACAATTCCAGCTCCCCCGCCACTTCCACCTGCTAGCATGGGCTCAATTAATGCTACAGCT
GCTTCAACGAGACCACCCAAGCGGAGAGCCTCTACAAAGAAGGTGTCAGACGCAAGTTCATCGCTGAAAGTTACGCTGAAGCTTCCGCCAGGGTTTATCC
CGAAGAACAGCGGTGCGGCAGCACCCGGGGCGAGTGGTAATCGATCAAAGCTCAATTTTCACGTGACAGATACGAACGTCACGGCAACGAAACGATCACG
AACCTCAACTGCTGCAGCAAAAAAAGCCAAGTCTACTTCAGGTCCCAGACCCTCGAAGAAAAGGCAGCCTGTAGGTCGTGCACAACCAACTGCGGCGGCA
GGCCTAAATGGGGCTATGCCTGCCGTACCAAATGTTCCGGCCGGTCCGCCAATTCTACCCAAGTTAATCCCGAGGGGACCAACTGTGCCTGCAGGTGAAA
TTCGTGGCGCAAAAGAACTATCACTCGTGGACCCTGCTCTACTTGTCAATAGTCCTCAAGAAACGATAGAGTCCAACATCCCGGCGCATTTCAATGACCG
GTATGCTCAGGGAGGTGACATTTTGCGTCTCTTGGATATGTTTTTCTTCTGCGATGAGAATGGGTACGTCAACTCGCCCATTTCTTTTGGAGACTAGAGA
ACTATTCTAACATCTTGTCATTTACTTTTTTTATGCTTACAGCAAAGCAATCAGCCTTGAGATTTTAGATCGGCCGAAGGATCAGCGGCCAAAAATTATG
GGGTTTGGTACAGTTGTAGAGCATTTACCAGTGGCAGAGCGTCCTCTCCCGATTAGGCCCATTCTCGCATCTCCAGCGTTTCCATCGCGGTCCAAAAAGC
GCCCACGCGCCAACTCGTCCGCTTCTACCCCCGCAAAGTCACCTGCTTCAAAGTCACGGGCAAATATTGATGCTTCAGACTCTGGCAATGAAAACGACAG
CAAGCGTGCGAAAGTAGAAGATGAAAGAATGTATCAAGGTGACGGCGAGTTCGAAGAAGAGGCCGACGACAAAACTTCGCACTTTGAAAAGCGCAGGATT
TTTCAGCGTGCGAATGTGTATCATTTCCCGAGGTCGTATTACCAGAATCATCTGTCTCAAATGGACGGACAATCTGATTCGGATAGTGGAGGCAGCGATC
TAACCTCGGACGATGAAGACATTCGTTCGGGCCGCGGTGGTTCAGGCGCAGGCTCAGACAATGACAGCGAACTCCTTTCTTCCGGCTCCAGTAGTTCAAG
TGGAAGTGAAAGCGACAACGACAATTTTTCTTCGTCCGGGACCGGGAGCAGTGATGCAGAAAGCGGAAAGGGGGTTACTCGTACTTCAGCTGCCCGGCGT
CCACTGACAACGAGCACAGGAGCCGAACACTTGCCTCAATCGGCTGCAGAGACTAAAAGACCTGTATCAGATAGAGTGCAAAGAAGACCGAGTACCCGAG
TCGATTCAAGAAATGGTGGATTGCCATCTGATGTCGTCGAACTAATGCGGACCGACCAAGCTGTAGAAGTTAAGGCGACGGGTACCCCCGACGAGCTCAA
CTTGATGGAGTGCGGATTTCGCCATCCCCCTACCTACGCACGTACTCGTGTTTTTCTCCCGGAAATTACGGACTGGTGTCTCGACTACGCAGAGGGGGAC
CCTACGTTGTGGGTTGTCACGCCTCATGCCTGGTACAAGATCGCTGGACCGTTATCTGGATTGTTACCGCACTTGTCGTATCGTCAGACTTTCAAGCACG
TTCGGCATCTGTTTGAGGCGAGCTACCTAGTGGCGTACGTTCTCAAGGAATGGCTGCCCATTAACAAGAAGGTGTCATATCGAGCAACTCTTCAACAGAT
TATCGAGCTATCTCTCAAAGGGAGATATCGAGTGGTACGGTGGCGTGGTGTGTGTATTGGGGTTCGTATTGATTTTCTAACATCAATGCTGTTGAAAATA
TGTGCCTTGTAGTCAGCCTGGTTTCTTGTGAAGAATTACCCGTTCATCCGAGCCCAGATTTGTAATCTATTTCCTGACAAGGACACATACCTGGAATCGA
TGTTCTTTAAGCAACTGCACCGTCTGCACGAAAATTACACGCTGCGCCAGGCGAGACACCAAAAAGAAATGGCTGAAAGGGAAGTTCGTCGCGTAAAACG
AGAAAATGAGCGCCTACAGAAGAGGCAACTGGTTGAAGATGAGCGACAACGTTTGAAGGATGAGCGTGACGGCGAACGGAAGCAGAAAGAAGAAAACATG
AAGTACCCAGTGGAAGACTTGCGACTGCTCGGGGAAGATGAAATTAACACAAACAGCCTGCCATTGAGCTGTTCAAGTCTGAAAGATGTCCAAGGCTCAT
TGCTGGGAGAACTTATCATGGCGTGGCAAACAATCTGTACGTTCAAGGATTTCGTTGGACTCGAGTCGATTTCGTTGGAAGCTCTTGTGGAGTGTATCAC
GGCTCGCTGTGACGAAGGGACGGATGTTGGTTTAGCCCGCATCTTCATCGCCTTCTTACGAGTTATTCTGTCGGAAAAGTCGTTTATGTCACTGTTGGAT
GATCTCGTCGTGGAAGGTAATAGCAAGGTGTCGGACCTGTTTGTGAGCAGTGACCGGACCTATGGAATTTGTGAGCGTGCCTACGGTGACATGCTGAATG
CAGTCACTTGGCAAGAAATTCTCCGCCAGTTAATGTCAAAGGATCTGGGGATTGATCCGTCTATTGGCCATGTGGAGCCGTTGGTGGGATGTGAGATTGT
TCGACAAACGCTATACATGCAAAACAATTCTGGTCCTTTCAATGGTCCAGTTGACACGTCTTTAAAGGGACTCGAAGATTACTCTCAAACCATCAAGAAC
CCGATGGATCTCCGCACAATCAAAACGAAAGTCGACTCGGGAAAATACGAGGGATCCGGTGGATACGAGAAATTCGCTGAGGATATTCGTTTGGTGTGGG
ATAATGCCGTACTATACAATGGTGAGGAATCTGAAGTGGGTCGTGCTGCATTGGCGCTGTCGGATGTTTTCGAACTGGACTACGAGCGGTTTGTTGTTGG
GCGGGTTCGTGCAAATCAAAGCCGGATTGAAAGTTGCAAGAAAACAAAGGAAACGCTTCAAGATCCGTCCGCAGAGCAGCTCACGTCATTTCAATACTCG
GACGTTGTGTATGGTTTATACGTATCGGAGTTTCACGAACTTCCGACGGCATACAAGATTGGTGCTCTCTCGTGGATCTGCTCGGAATTCTTGACATTGT
CGAGCATCCGGACTTATATGGCATCTCAGGTGGAGCAAGAGATGCTGATTTACCGGAATCACAGAAAGCGTGCTGCCGATTTGGATACGCAACGAAAACA
TGCAGACCGAATGCGTCGCGAAAGGGAGAACGCCTTTAGAAGGGATTGTGCAAACCAGGGTATTCACCCCAATTCGCACAACGTTTTCTCGGAGGGTATT
AAGCGGCGTCATGAGTTCATCGGCAAATTTTTTGAGGACATGCAGGCAGAAAAGATCGAAGACGAAAAAAACGTGGAGCAGGAGAAAAAGACCCAGGCGG
AGGAAATGGCGAGGGAGTTGAGCTCACTTGTTATTCGCGAGTCTCCTTTGGGAAGAGACAGGTACCACAACTCCTATTACATGTTCAAGCACGATACGAA
GCCACGATTGTTCATTGAGCGTGCAGACTCCGGAGACTTCGTGGTTTGTGGCCATAAAGACCAGCTTACGAAAATCCTGGAGTGGCTGAACCCCAAAGGC
GTTCGAGAGCTGGACTTGCTGACAAAGTTGGAGGAACTAAAGGACAAGTTGCTTAGCGGCTTCGAGCAGGACGGTGCCACTACAGAGATTGTGTGGAGTG
CAAAGAGTGGCATTGAGCTTCAAATGTTTCCTCTTCCTGGCGGTGCTGTCAAGAGTGAGGTTATGACTATCACAGACGCAGATACGGTTATCAAGTCATG
TGATATTGCTCGCAAGATGCTGCTGTGCTTGAAACAACATCTTGATAACACGAACACGTTGCCCGCTTCGTGGGAAGGTGCTCAGACGTGGAGTTCTCGT
GTGGAAGATGCAAAGTCATTCAAAGATCAACTGAACTTGTTTGCGGAACTAGAAAATGCGGCAGTGGAAGCTTTGAGCTCAGGAGTGGAAACAATTCGCC
CTTCCTGGCAGCGGAAACGACACGAGTGGCGATTGGCACTGGAGGGTTCTTGCACATACGCCCAGCTCGTGTTTCTGCTGCACTTGCTGCTTGAAGAGTT
TATCAACGTTGAAGCTTTTATGGATCTGCACATTCGATTGGACCGACTGGAATGGCTCAAGTTGCGACCCAAGGAGACTCGCAATTTTATTCCTGAGGTT
GGAAAGGTTGTTGTCTACTTCGGAGATGGCCATTCGCTAGCGTTGAAAGAAGACGAAAAGTCCAAGAGAAAGCGTTTCACACAGAAAAGCGATACTCCGA
TTCGTAACACGACAGTAATCTGCACCGTGGAGAAGGTATCTTATCACCATGGCGGTGGTGACCCATACGCATTGGTTGTGCTACAGCCGATTCCGGATAT
GGCGCAGCACGAATGCACCCGTGAGCCCGAAGCCCTACTGTGCCCTCTTCCGTCCCGAGAGCAGAGGCTCGCTCGAGTATTTTTGCGAATTTTGGCAAAG
CTGAAGATGCTGGCCGATGCCGGTCCGTTTCTGGAGCCTGTATCCGATCGAGAGTTCCCGCAGTACAAGGAAATCATCTTACATCCCATGGATCTCGGTA
AAATGACTGCGAAAGCCAGCAACCTGGAATACAACAGTTCAGCGGAGTTTATGACTGACCTGAGGCTTACGCGGGACAACTGCCAGCTCTTTTGCGAAGG
TCGTTTCCCAACACTGCCACCGTTGGCCCACAACTTGGTGTACGTGGCGGATGGACAAATAAAGAAGTGGAGCAAGGAAATTCGAGCATGTGAAGAAACG
TCGGGTGAGTCGGCACCAGTCAAGAGAGGAAGCACGTCGTCCCCCGAGAAAGCTCTCGACAAGCAAGTCGAGCCCGAGGCTGAAAAGCAGGTATCTGCAG
AGTTGCCAACTCGTTCCATTGTGACGATCTTGCGCCTCGAGAATCGATTGCCCGAGTACGTGGTAGATATCAGCCGATATTCCTGGGCAGTAAATCGCTC
GTGGCAATGCGGAGAGAAGTTTCGAATGCTGTTTCGCAACCCGCAAGGGCAGCCTGGGGAGTACTATGGAGGCGTGACTGCAGGGTCCTTACCGTTTGAT
GAGCATGGAATGCTGCCGTGGGAGGCGCTACGTATTACGTGGGACGAAGATGATGGCTCAGACGACAATCGTATTAACCCCTGGTACGTAATTCGATGGC
ATGGAAAAATAGGCTGTACTTGTTTCTCACTCATTTTGTTATCTTTCACAGGGAGGCGGAGCTTCCTCGAGGTGGAAATCGGGGGTAGATAGAGATAGAT
GTTCCCAGACCCGGCGTTCAGGAAACCGTGTCGCCAAAACAGCGTATATTATCGCTGGCCCAAATGCATTGTCACGTTGAGGAAAGCTAATTCTCACTCG
ATTGTTCTTGTTGTTTTTAGCCTTGGTGGGCCAAGACTCTTGTAAGTCTTTCAGTTTTTTGTATGCTTGATCTGAGACCAGAGGAGCCAGACTAAAGTGG
GACCCCTGCCTCTCATTTTCCGAACTCAAGGGCAGACTAAAATGTGGGATCCAGTCTACAAAACGCTCCTTCTGCGAGAACATGGTGTCCAGTGTGTTGC
CCAGCAGAGGCAACGTAGACTGGGGACGATGAATCCGCCGGGAACTTTCATCTGCTGCCTTTTGCGTAGGAGAACGCAGCGTATGCTTCAGCACCTTCCA
ACCCAGTAATACGACGACAAACGCTGTTCCAGCAAGCACAGCTTTCTGGTGTTCGTGTGCTTTTCAAGCCGCAGTTGGCTCGGCTTCCGTACCTCGAAGC
AGCCATGCGTGAGAACTTGCGTCTAAACACCAGCATGACCACACGTTCGCCCAACCAAGACACGACTCTGAGCTGTGGAACTTTCATTCCGAAAGATTCG
ATCGTTTATGTGTGTCACTACGCTTCCGCGCGGCTAAAAAGCACTTGGGGCGAGGATGCTGCGGAGTTCAAACCTGAGCGATGGATCGACCCTGAAACAG
GAAATTTGCGCCAATTCTCGCCTTTCAAGTTCGTCACGTTCCTTGCTGGACCTCGTCAATGCATCGGCATGCGGTTTGCAATGTTGGAACTACGCATGGT
AGCTGCCGTGCTTTTCAGTCGCTTCGATATCAAGACCGTCGACGACCCGTTCGATTTGACTTACGAGCTTTCGACTGTCTTCCCGGTCAAGGGCCGCTTA
TTGTGCACGGTCCAGTTGGTAAAGACAGCCACAAGCTAA