Transcript Name :
Phypl_g750
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_552333
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Cation-transporting P-type ATPase0.00000047PR00119
Cation-transporting P-type ATPase0.00000047PR00119
Cation-transporting P-type ATPase0.00000047PR00119
Cation-transporting P-type ATPase0.00000047PR00119
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.3930.2081373
InsideOutsideTMhelix
1-132
133-155
156-166
167-186
187-200
201-223
224-352
353-375
376-589
590-612
613-631
632-654
655-1300
1301-1323
1324-1352
1353-1375
1376-1398
1399-1421
1422-1432
1433-1455
1456-1476
1477-1496
1497-1601
*** None ***
PositionContextScore
294PNNRLRR|SQ0.716
*** None ***
GO
Biological ProcessGO IDPrediction Method
integral component of membraneGO:0016021IEA
cation transportGO:0006812IEA
*** None ***
*** None ***
Sequence
        4805 bases(100 bases per row)
ATGCGCGTCGAGTTCGCGGTGCCCTCGCCGTCCGACAGCGCTACGGAGTACACGCTGGACATACAGGCGTCCACAGACAGCGCGGCGCCTCCGTCCTCCG
CCACGCAGGCACCGACGTCGCAGCCTCTGGCGCACAAGAACTTACGGCGCGTCAACACGTTCACAGGTGTCCCCAATGAGGAGGAGCAGCGCAACATCAT
CTCGCTGCGTTATCGAGCCGACAGCATGGCGGACTCGGTGGCGTCCGATACAAAACCCAATGCTGAGACCAAGCTGTGGAATCTCTTTGAGAAGGTTTTC
TGCTTCCTCAAGGGCATGACCATCTACCAGACCCGACGTCGTCTCAAGTTCACTATTGTGTCCCAAACGATCATCAACTCGCTACGTATCTTCCCTATTA
TCCTGGGACTGAGCTTCCAGGCTACAGTGCCGGTGCTTATCCTGTATATCACGTTGGTACTGGGCTGGCACGGCACCAAGTTCCTCGTACCCAAGTTCCT
GCTCAGTTACAAGATCGGCATGCAGCTTACACTGCTCGTGGACGTCATCTGGTACTACAAGGGCTACAACGGCAAGCTCAACAGTGTCAGCAGCGGTACT
TCCGTGCTCATGCAGGGTTTCTTCTCCATCCTGCTGACGATGCTCAACATCACGGGCTTCATGTACGGCTGGAAGCTTCGTCGCATCGTCAAGGCCGTGC
AGAACCAGAGAGAGTGTGACCGAGCTGCTTTAGCCACGATGATGCCGTCTCCGCAGCGGGTCAACTCGCTCCATCAGACGCTGTCTATTAACCCGTCGGC
CGAGATGGATGAGGACGTAGGACCTACGGCTCGTCGGAAGATTGTGGTGGGTCCCGGCGTCCCGAACAACAGGTTACGGCGTAGTCAGTCAGGCGTGTCG
CTGTCGCTGCCGGAAGCGATGAAGACCAAGAACCAGCGGAGGAAAGAGGCGGAGGCACAGGAAGAAGCGCCCGTGTTCTGCTCCAACCTCATGATTACGA
GCAAGTACACGTACTACAACTTCCTGTTCGTGTTCCTCAAGATGCAATTCAGTCGACTGGCGAATTTCTACACGACCATTGTGGTGGCGCTCTGTTTCTT
CGACTTCTCGCCTGTGAGTCCCGTGGCCAGTCTGACGCCGCTGCTGATCGTGTTCGCGACCTCGGCGCTGAAGGATGTGAGCGAGGATCTTCGCCGACAG
AAGGGAGACGCTTTGGTGAATTCTAGGGCGGCGCACATTGTTCGTCGCGATGTATTGGACGAAGTGATGCACATCGATGGCACATGGCAGGATATTGAAG
TGGGAGATGTGCTGCTACTGAAGGACGGCGATCAGGTTCCTGCGGATTGTGTTCTACTGGCCACTAGCAGACCGGATGGAAGATGCTACGTGGAGACGGC
CAACCTTGATGGCGAAACGAATCTCAAGATCCGACAGGTAGCGAGCTGCACGAAGCATTTCTTGACTGCTGAGGAAATCTTGGACCGGCATAAGCTCGAA
GTAGAGTGTGACGTGCCCAACAAGGACCTCTTCTACTTCGACGGTGTTTTAAGGCTGGGAAAACTCACAGACGAAGCTGTCACAGATGCCGACAAGGAAG
ACAACGAGACCAGTTTGACCATGGACAATTTGATTCTACGTGGAAGTGAAAGCCGTAACGCCGAGTGGACGCTTGGGCTTGTGATCTACACGGGCAAGCA
AACGAAGGTCCAAATGAACTCTGTTGCTGTGCCGCTGAAACGTAGCTTTGTGGAGAAGACCTTGGACACCATGTTCGTGCTGGTTCTGATGCTGCTTTTC
GGAATTTCGATCGCCTGCACGCTAGGCAACAACAACTGGAACTTGGATCTGGCGGATGAGACGACGCCGTGGTACATCCAGGAAGACTCGAACGGCTATA
TTTTCTTGAGTTACGTGATCTTGTTCAACAACCTCATCCCGCTCTCGATGTACGTGACGATGGAAGGCGTTCGGTTTGTTCACGCGCGTTACATCGAAAA
CGATTTGGAAATGTACGACTCTAAGACAGACACTCCGGCACAGGTTCGCAACAGCAATATCAACGAAGACCTCGGACAGATTCAGTACATTTTCTCGGAC
AAGACAGGTACTCTCACGTGCAATGAGATGATCTTTGCGAAGTGCACCATTGGGGGCCTCAGGTACAATGATATTGAAGTGGACCCTGCGAAACCTGGAC
GACCAGGCACACGGTTTAATGATGGGCGATTGCTGGCGCGACTGAACTCGAATCACTCAACGAAGAAGGAGATTCATGACTTCTTGCTGCTACTTACGAT
TTGCAACACGGTGATCCCGGAGAACAACGTTCCAACGTCGCCGACATCCAGCAGCGACTCCTGCTCAGCTCCGACCTCGACGATCAAGTACAACGCGTCT
TCCCCTGATGAGGAGGCTCTTGTGCTGGCTGCTGCTGACCTAGGCTATGTTCTTGAGTCCCGTGATGGTCCAATGTGCAACACGCTTATCCAGGGAAGGC
CCATGTCGTTTGAGATCCTGAATGTACTGGAGTTTAACAGCGACAGGAAGCGTATGTCGGTTATTGTGCGATTCCCTGACGGGAGTATCGTGCTCTACTG
TAAGGGCGCCGACGACATCATTTTCGACTTGCTGTCAAAGTCCCAGCCTCAAGGTGTAGCTCACGTGACTCGTGGTCATCTCCAGGAGTATGCATCCGAA
GGTCTTCGAACTTTGACGACTGCTATGCGGCGCCTTACTCAGGAGGAATATGACCAGTGGAACCAACTGTACCGACAGGCAGAGTTTTCCATGGAGGGGC
GAGCCGCCAAGATTGCTAAGGTTTCAGCCATTGTTGAGGTCGAGTTGACTTTGCTCGGTGCGACAGCCATCGAGGACCGACTGCAAGACGGCGTGGAGGA
ATCCATCTGTGCCCTACGCAAGGCTGGTATTAAGTTCTGGGTGCTCACTGGTGACAAGAAGGAAACCGCGCTCAGTATCGGCATGTCATCGCATGTGATC
GATGATAATATGGATGTGATCGTCTTAGGTCAACGCGACAAGGGTTCTCTGCGTACAAGACTGGAGGAGTTGTACGTCGACCTTGTAGAGGACAAGTGGG
GGTCAGACGAAACGTCTTCAGCAGTCAGTGTGCTGTGGGAAGCTTTGAAGCGAGCCATTTTGTACCTATGGGATCTCGTGAAACTTGCGCTGGTCGGCCG
AGACGAAGAAGCAGAAGCACGCAAAAAGCGGAGGCGCTTGCCAAGACGTGAACATGCTGGGGCTGAAACACCGACCGATAGTCCTGCTCACTATGACGAG
GTGTATCCCGCCCTACCAAACCGTGACATTACTGAGAACAGCTTCGACCGAGATTTGTGTGACCATGACTTCGAGCCGAAGACTGACAATATGACGGGTG
GCACGGGAAGTATGAGCAGTGGCGATTACGTGGACGAGGAGCTGGAGTTTGCCATGGTGATCGACGGCAAAACGCTCGCGCTAGTGCTGGATGACGATAT
CAAGTATCTCTTCTTGGCGGTGGCTACGCAATGTAAATCGGTCATTTGCTGTCGCTGTTCCCCATCCCAGAAGGCGTCAGTGGTCAAACTAGTTACGGAA
CCCACGCTCATGTTCTCACCAGGCAACATTACACTAGCCATTGGCGACGGCGCCAACGATGTGCCTATGATTCAGGCCGCCAACGTTGGTGTCGGCATCA
GCGGCAAAGAAGGTCGTCAGGCTGTTCTCTCCAGTGACTACTCCATCGCAGAGTTCCAGTACTTGAAGCGTCTGTTGTTGGTGCACGGCAACTACAGTTA
CAAGCGTATTTCCAAGCTCATCCTGTTCTCGTTCATGAAGAACGTGGCGTTGTCCATGTCTAACTTTTTCTTGGCGATGGAGACGATGTACAGTGGTTTG
CTCATGTACTTCAGCATCTTCTTCACGCTTTACAATGCGCTTTTCACGACGATTCCCATCGTGGTGATTGCCATGTACAACCAAGACGTGTCTCCAGCGG
TGCTGATGCAGTACCCGACACTCTATGTGAACGGCTTGAAGAACCGGTCTTTCAACTGGCTCTCCTTCTTCGGCTGGTGTGTGCTGGGTGCGTGGCATGC
CTACGTGGTATACGCAGTCCCGTTCTTCTCGAATGGTTCTATTGTGTGGTACTTCTCGAGTGGTTCGTCCACACTGCAGTTCGATAAACGCGACTTGGGC
CTTTGGGCAAACGGTGTGGCATCGTACACGTACCTGATCACCGCTTCAACGGTGCAAGTGTCGCTCATGACGAGTAACTGGACGCGGACCAACGTCGTTT
CTACTATCGGTACACTGGTGTTCTACTACCTGTTTACAGCGTTCTTCTGTGCCGTGTTCGGATGGACCAAGGCCGATTTTTACGACACCGAAGTTGGCTT
TGGAGTAGTCAGTCAGCTTGTGCGCGAAGCCTGGTTCTGGCTTGGTCTGTTGCTGTCTGTGATCGTTGCCATTTTGCCCAATTACATCGCCAAGGCTGGA
CGCGTGCTGTTCTACCCAGAGCCGTCGCACTTAATGCGTGAGTGGAATCGTTTGGCGAAGGGCGAAGATGCCGCTGTGGTGATGGACTCGCCGCGCCTTG
TACGTCGCAACACTGGCTTTGCTTTCTCTCACTGCCCTGGCGAGACGGAGATGGCGTTGGGTATTTACCGCAGCAGTAATACCAGTACGCGTCCACAGAC
CCGTGCAGGGCAGAGGTCAGACCTCTCGGACATTGGCCTGCGTGTGCCGTCGCCGTCGTCGTCCACCGCTGACGGTTCTACGCCGTCCCCCAAGACGCTG
TACTA